We narrowed to 7,197 results for: mcherry
-
Plasmid#203442PurposePlasmid expressing active RfxCas13d with mCherry reporter for investigating CasRx activityDepositorInsertRfxCas13d-T2A-mCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP
Plasmid#61527PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingPromoterCAGGSAvailable SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PdTK-CAG-mCh-[uBglII]
Plasmid#107280Purposepuro-deltaTK gene-trap selection cassette (AAVS1 donor vector backbone) with constitutive mCherryDepositorInsertAAVS1 puro-deltaTK; CAG-mCherry (PPP1R12C )
Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-mCh (VE5626)
Plasmid#139772PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with mCherry cDNA under p10 to monitor infection.DepositorInsertmCherry fluorescent protein
PromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(RK)
Plasmid#27136DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationArginines in the SH2 domains mutated to lysines (…Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Klf2.2A.Nanog-Cherry-pA-pgk-zeo
Plasmid#74919PurposeMammalian expression of mKlf2 and mNanog-mCherryDepositorTagsT2A and mCherryExpressionMammalianPromoterCAGAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pAC8_MF-p10-mCh PH-mCh (VE5625)
Plasmid#139769PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.DepositorInsertmCherry fluorescent protein
ExpressionInsectPromoterPH or p10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSN33
Plasmid#100118Purposeexpresses a chimeric KLF4-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEnt R3L2 TetO(sh) mCh-Rs1-2
Plasmid#24417PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Plasmid also known as pEntR3L2 TetO-mCh-Rs1.DepositorInsertRs1
UseGateway CloningTagsFLAG and mCherry-P2AMutationD100APromotershort TetO, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H334
Plasmid#245738PurposeFLIM biosensor for real-time cAMP monitoring, no nuclear membrane affinity, with nuclear photoactivatable mCherry. mT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST)-2A-PAmCherry-3xNLSDepositorInsertmTurq2del_EPACdDEPCD_Q270E_L777A_K778A_tdblcp173V(st)
TagsT2A, Photoactivatable mCherry-3xNLSExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterEF-1aAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H250
Plasmid#245739PurposeFLIM biosensor for real-time cAMP monitoring, with nuclear photoactivatable mCherry to label nuclei of selected cells. mT2Del_EPACdDEPCD_Q270E_tdBlackcp173Venus(ST)-2A-PAmCherry-HNSDepositorInsertmTurq2del_EPACdDEPCD_Q270E_tdblcp173V(st)
TagsT2A, Photoactivatable mCherry-HNSExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …Available SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-BCPp-NLS-2xmCH_STR1p-cYFP-STR1g_STR2p-nYFP-STR2g
Plasmid#254407PurposeBiFC plasmid with cYFP-STR and nYFP-STR2 expressed from their native promoters and MtBCP1-NLS- 2X mCherry.DepositorInsertsSTR promoter-nYFP-STR_STR2 promoter-cYFP-STR2
M. truncatula BCP1 promoter - NLS-2X-mCherry
ExpressionPlantPromoterMtBCP1 promoter and STR promoterAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT7-V5H6.MCh.Puro
Plasmid#209946PurposeIn mammalian cells expresses TP fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6L-V5H6.MCh.Puro
Plasmid#209945PurposeIn mammalian cells expresses TP fused to a CNOT6L with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHPHS926
Plasmid#228237PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin NMD reporter with premature termination codon for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianMutationPTC39PromoterTRE3GV and noneAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHPHS927
Plasmid#228238PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible β-globin reporter for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
Beta globin
Tags3xFLAG, HA, and PuroRExpressionMammalianPromoterTRE3GV and noneAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-855
Plasmid#218013PurposemCherry fluorescent proteinDepositorInsertmCherry
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSR13
Plasmid#69155Purposeread-outloxN mCherry to GFP switch, with swsn-1 promoter, gene (partially cDNA) and UTR, for integration on on ttTi5605, Mos Chr IIDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0, codon-optimzed index 1.…Promoterrps-27 and swsn-1Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AV0-BWS-2.0-mC-G-CL3B
Plasmid#124975Purposeevaluate autophagyDepositorInsertmCherry-GFP-LC3B
UseAAVPromoterEF1-alphaAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p41Nat MagicFluor
Plasmid#58563Purposep41Nat carrying both mating type markers buffered by the Cyc1 terminatorDepositorInsertSte2p-Citrine, Cyc1 term, Ste3p-mCherry
ExpressionYeastAvailable SinceNov. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
p41Neo MagicFluor
Plasmid#58564Purposep41Neo carrying both mating type markers buffered by the Cyc1 terminatorDepositorInsertSte2p-Citrine, Cyc1 term, Ste3p-mCherry
ExpressionYeastAvailable SinceNov. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-NLS.EGFP.P2A.Cherry.CAAX
Plasmid#52421PurposeExpresses a polyprotein cleaved by peptide 2A into nuclear GFP and membrane located mCherryDepositorInsertFusion NLS-EGFP-P2A-Cherry-CAAX
ExpressionMammalianPromoterCMVAvailable SinceApril 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
Bidirectional MYC 5'UTR Dual Fluorescence Reporter
Plasmid#229498PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.DepositorInsertMYC 5'Untranslated region + destabilized GFP
UseLentiviralExpressionMammalianPromoterEf1aAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PC1575
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPΔTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p37-2iDMD-LR
Plasmid#88892Purpose37°C full-length DMD luc-red plasmid. Co-expresses human dystrophin, firefly luciferase and mCherry in mammalian cells. Plasmid carries phiC31 and Bxb1 attB sites and can be grown at 37°C.DepositorInsertsExpressionMammalianAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Endo-INPP5E
Plasmid#236005PurposeEndosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorInsertEndo-INPP5E (INPP5E Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDMD-puro
Plasmid#88895Purpose28°C full-length DMD luc-puro-red plasmid. Co-expresses human DMD, firefly luciferase, puroR and mCherry in mammalian cells. Plasmid carries phiC31 and Bxb1 attB sites, but *cannot* be grown at 37°C.DepositorInsertsExpressionMammalianMutationcodon optimizedAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
yeast_DualReporter
Plasmid#127546PurposeA dual reporter vector modified from Sharon et al (Nature Biotech, 2012) containing Ura3 and Nat1 selectable markers, a constant background RFP (TEF2::mCherry), and a variable YFP (pTpA+MCS::yEVenus).DepositorInsertsUseSynthetic BiologyExpressionYeastPromoterTEF, TEF2, URA3, bla (E. coli), and pTpA+MCSAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-GsCT
Plasmid#205516PurposeEndosome-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertendo-GsCT (GNAS Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuc-GsCT
Plasmid#205517PurposeNuclear-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertnuc-GsCT (GNAS Synthetic, Human)
TagsHistone H2A and mCherryExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh
Plasmid#31847PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Zebrafish, Human)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only