We narrowed to 31,863 results for: ica
-
Plasmid#99563Purposemammalian expression of TMEM230-dsRed (isoform 2)DepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLViN-iRFP670-α-cateninA+
Plasmid#229703PurposeLentiviral expression of iRFP670-alpha-cateninA+ in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM11-SUMO3-KSR1-CA3-sfGFP (C-KSR)
Plasmid#217766PurposeFluorescent reporter for ceramide (for bacterial expression and purification)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseProtein purification (6xhis tag, tev site, sumo3 …TagssfGFPExpressionBacterialMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterT7 promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TMEM230-WT-pEGFP(isoform 2)
Plasmid#99562Purposemammalian expression of TMEM230-GFP (isoform 2)DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3Ai E72A-Cas9n-UGI-NLS
Plasmid#109430PurposeExpresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-pEGFP(isoform 1)
Plasmid#99561Purposemammalian expression of TMEM230-GFP (isoform 1)DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-IRES(isoform 2)
Plasmid#99564Purposemammalian expression of TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
Plasmid#113162PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable markerDepositorInsertSpCas9
TagsFLAGExpressionMammalianMutationD10APromoterCAGAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe-kappa-HA-dL5-myc-ADRB2
Plasmid#101253PurposeExpresses HA-dL5(E52D)-cMyc N-terminal fusion of beta-2 adrenergic receptor in mammalian cells, MMLV retroviral plasmid (MBIC5, dL5**, FAP, ADRB2)DepositorInsertkappa-HA-dL5-myc-ADRB2 (ADRB2 Human, Budding Yeast)
UseRetroviralTagsFAP-dL5 and HA epitopeExpressionMammalianPromoterMMLV LTRAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-hTRF1deltaBLM
Plasmid#64165PurposeRetroviral vector expressing human TRF1 delta aa317-374 with N-terminal MYC tagDepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsMycExpressionMammalianMutationdeleted amino acids aa317-374 of human TRF1PromoterCMVAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-IRES(isoform 1)
Plasmid#99558Purposemammalian expression of TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLViN-iRFP670-α-cateninΔβH
Plasmid#229706PurposeLentiviral expression of iRFP670-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninV-
Plasmid#229696PurposeTransient expression of GFP-alpha-cateninV- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationL344PPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only