We narrowed to 9,048 results for: sgRNA
-
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH009_proD_Cas12c-sgRNA-GFP_CAM
Plasmid#183070PurposePlasmid expressing Cas12c sgRNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertCas12c single guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-P2A-EGFP-PJY463
Plasmid#254300PurposeCloning backbone for guide RNAs compatible with 10x FLEX and CROPseqDepositorInsertSFFV-Puro-P2A-EGFP-WPRE-hU6-sgRNA
UseCRISPR and LentiviralPromoterSFFVAvailable SinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2
Plasmid#247679PurposeTargeting Cldn5 gene in vivo by adeno-associated viral vector-mediated deliveryDepositorInsertCldn5 sgRNAs
UseAAV, CRISPR, and Mouse TargetingTagsnls-TagBFP2ExpressionMammalianPromoterU6Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg2
Plasmid#244864PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg1
Plasmid#244863PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP1L sg2
Plasmid#244850PurposeKnockout of human IMMP1LDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP1L sg1
Plasmid#244849PurposeKnockout of human IMMP1LDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA2-EGFP
Plasmid#226005PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-49535-sgFmr1_CGG5-2
Plasmid#222964PurposeTargeting FMR1 5' UTR for CGG deletionDepositorInsertFMR1 sgRNA (FMR1 Human)
UseCRISPRAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only