We narrowed to 9,067 results for: sgRNA
-
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-SCN8A-SVA-BFP
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDM002-sgRNA-lenti-ZeoR
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available sinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable sinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2
Plasmid#247679PurposeTargeting Cldn5 gene in vivo by adeno-associated viral vector-mediated deliveryDepositorInsertCldn5 sgRNAs
UseAAV, CRISPR, and Mouse TargetingTagsnls-TagBFP2ExpressionMammalianPromoterU6Available sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg2
Plasmid#244864PurposeKnockout of human HTRA2DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg1
Plasmid#244863PurposeKnockout of human HTRA2DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP1L sg2
Plasmid#244850PurposeKnockout of human IMMP1LDepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP1L sg1
Plasmid#244849PurposeKnockout of human IMMP1LDepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA2-EGFP
Plasmid#226005PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-49535-sgFmr1_CGG5-2
Plasmid#222964PurposeTargeting FMR1 5' UTR for CGG deletionDepositorInsertFMR1 sgRNA (FMR1 Human)
UseCRISPRAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF398_5-2)-PGKpuroBFP-W
Plasmid#211998PurposeExpress gRNA against ZNF398 with puro and BFPDepositorInsertsgRNA targeting ZNF398 (ZNF398 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF398_5-5)-PGKpuroBFP-W
Plasmid#211999PurposeExpress gRNA against ZNF398 with puro and BFPDepositorInsertsgRNA targeting ZNF398 (ZNF398 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only