We narrowed to 3,367 results for: aaas
-
Plasmid#77964Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SETDB1 ts3
Plasmid#115861PurposeSETDB1 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001148252)
Plasmid#77955Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgp27#1
Plasmid#102759PurposeExpresses sgRNA targeting mouse p27DepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2842C
Plasmid#139324PurposePlasmid expressing a sgRNA to introduce BRCA2 R2842C using base editingDepositorInsertsgRNA to insert BRCA2 R2842C using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
ROR1 gRNA (BRDN0001162245)
Plasmid#76043Purpose3rd generation lentiviral gRNA plasmid targeting human ROR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MO70-hJunctate - EF-mutant
Plasmid#79597PurposeTransient and retroviral expressionDepositorInsertjunctate (ASPH Human)
UseRetroviralTagsFLAGExpressionMammalianMutation77DAD79 to 77AAA79PromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P MUTYH_1
Plasmid#160785PurposeSuppress MUTYHDepositorInsertshMUTYH_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pMCB320-sgNC.ACOCA
Plasmid#169836PurposeExpresses a negative control sgRNADepositorInsertsafe harbor sgRNA
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
ROR1 gRNA (BRDN0001145812)
Plasmid#76045Purpose3rd generation lentiviral gRNA plasmid targeting human ROR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK36 gRNA (BRDN0001145146)
Plasmid#77276Purpose3rd generation lentiviral gRNA plasmid targeting human STK36DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK36 gRNA (BRDN0001148669)
Plasmid#77277Purpose3rd generation lentiviral gRNA plasmid targeting human STK36DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ULK2 gRNA (BRDN0001145025)
Plasmid#77261Purpose3rd generation lentiviral gRNA plasmid targeting human ULK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_1
Plasmid#106314PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only