We narrowed to 2,466 results for: crispr system
-
Plasmid#130639PurposeExpresses V. cholerae CAST Cas8, Cas7, and Cas6 from a T7 promoter, with N-terminal His10-MBP-TEVsite tag on Cas8 for purification.DepositorInsertVchCas8, VchCas7, VchCas6
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on Cas8ExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
OmEF1aCas9P2ApuroSB
Plasmid#165484PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cellsDepositorInsertZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
UseCRISPR; TransposonPromoterOreochromis mossambicus EF1 alpha promoter (OmEF1…Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3Bmax
Plasmid#207167PurposeExpress full-length human A3B in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLS and NLS, 6x HisExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3B-Cas9n-UGI-NLS
Plasmid#198889PurposeExpress full-length A3B BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL0373 (His-MBP-TniQ)
Plasmid#130638PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite tag for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEL666
Plasmid#196814PurposeLrCas9 genome editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0008
Plasmid#42248PurposegRNA targeted to zebrafish gene tia1lDepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0376 (His-MBP-StrepII-TniQ)
Plasmid#130641PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite-StrepII for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite-StrepII on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0715 (pDonor_R1-57)
Plasmid#130644PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened right end. Total transposon size = 910 bp.DepositorInsertVchCAST donor DNA (short R)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterSlEF1aAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas_4(I-U)/1_2_VB
Plasmid#186445PurposeEncodes Cas4/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B). Cas4 domain swapped with type U-I Cas4 domain from G. sulfurreducensDepositorInsertCas4/1 and Cas2
UseCRISPRMutationCas4 domain swapped with Cas4 domain from G. sulf…PromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
Plasmid#42335PurposeA human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42229PurposeThis plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAC154-dual-dCas9VP160-sgExpression
Plasmid#48240PurposeDual expression construct expressing both dCas9VP160 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP160ExpressionMammalianMutationD10A H840AAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAC152-dual-dCas9VP64-sgExpression
Plasmid#48238PurposeDual expression construct expressing both dCas9VP64 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA Tag, HA-Tag, and VP64ExpressionMammalianMutationD10A;H840AAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgRNA
Plasmid#124845PurposeVector for FLP-dependent expression of SaCas9 with gRNADepositorInsertSauCas9 gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM201
Plasmid#173179PurposedCas9-24xGCN4DepositorInsertdCas9-24xGCN4
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM355
Plasmid#173175Purpose(Empty Backbone) Expresses gRNA-12xMBS from hU6 promoterDepositorInsertgRNA-12xMBS backbone
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
puc19-pCas13a
Plasmid#118963PurposeIntermediate/cloning vector that can be used for sub-cloning into final destination vectors based on one's requirements.DepositorInsertCas13a
ExpressionPlantAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
miniCMV eGFP hPGK BSD
Plasmid#188519PurposeBackbone for CRISPR activation (CRISPRa) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141D2.0
Plasmid#99906PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE35
Plasmid#174409PurposeC. auris LEUpOUT NAT marker CAS9 expression construct. Use with pCE27 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFC334
Plasmid#87846PurposeAMA1 plasmid with Aspergillus optimized Cas9, argB selection marker and yA specific sgRNA expressed with ribozymesDepositorInsertsCas9
argB
yA specific sgRNA
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterA. nidulans gpdA promoter with Hammerhead ribozym…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas12j2 KRAB
Plasmid#188508PurposeExpresses FLAG tagged dCas12j2 KRABDepositorInsertdCas12j2
UseCRISPR and LentiviralExpressionMammalianMutationD394APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas12j3 KRAB
Plasmid#188507PurposeExpresses FLAG tagged dCas12j3 KRABDepositorInsertdCas12j3
UseCRISPR and LentiviralExpressionMammalianMutationD413APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131A2.0
Plasmid#99884PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141B2.0
Plasmid#99897PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AsdCas12a KRAB
Plasmid#188502PurposeExpresses FLAG tagged AsdCas12a KRABDepositorInsertdCas12a
UseCRISPR and LentiviralExpressionMammalianMutationD908APromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a8
Plasmid#124848PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET47b-T7-enAsCas12f
Plasmid#204642PurposeExpression of enAsCas12f in E. coliDepositorInsertenAsCas12f
Tags6xHisExpressionBacterialMutationD196K, N199K, G276R, N328G, D364RPromoterT7Available SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA-gRic6T
Plasmid#106401PurposeE.coli-Pseudomonas putida KT2440 shuttle plasmid containing sgRNA targeting the KT2440 genome, and homologous arms.DepositorInsertsgRNA
ExpressionBacterialPromoterpj23119Available SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NLS-ddMisCas13b-SNAPf-NLS-3xFlag
Plasmid#191537PurposeOverexpression of NLS-ddMisCas13b-SNAPf-NLS-3xFlag in human cellsDepositorInsertNLS-ddMisCas13b-SNAPf-NLS-3xFlag
ExpressionMammalianAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC103-PBNeo-U6-sgRNA-Expression
Plasmid#48228PurposesgRNA expression on PiggyBac vector with Neo-selectable markerDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pM370
Plasmid#173178Purpose(Empty Backbone) gRNA-12xMBSDepositorInsertgRNA-12xMBS
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE38
Plasmid#174432PurposeC. auris LEUpOUT HYG marker CAS9 expression construct. Use with pCE41 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, HYG 1 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE41
Plasmid#174433PurposeC. auris LEUpOUT HYG marker gRNA expression construct. Use with pCE38 CAS9 expression construct.DepositorInsertHYG 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterial and YeastAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc18a2
Plasmid#124849PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc18a2
Plasmid#124862PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only