We narrowed to 81,061 results for: myc
-
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
AAV-hSyn-DIO-mCReP
Plasmid#167503PurposeConditional expression of the eIF2alpha phophatase, CReP (Ppp1r15b)DepositorAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
(383) pcDNA3.1-HA-nBC2-OGA(544-706)
Plasmid#168100PurposeHA- tagged BC2 nanobody fused to human OGA stalk domain residues (544-706). Used in combination with myc-OGA(1-400) to create split-OGADepositorInsertHA-nBC2-OGA(544-706)
TagsHA-tagExpressionMammalianMutationOGA truncated to contain residues 544-706PromoterT7/CMVAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MT mouse Axin (Axin MTFu1)
Plasmid#21287DepositorAvailable SinceDec. 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Foxo1-ADA 6KR
Plasmid#17561DepositorInsertFoxo1-ADA 6KR (Foxo1 Mouse)
TagsFlag and MycExpressionMammalianMutationK242, K245, K259, K262, K271 and K291 were replac…PromoterCMVAvailable SinceOct. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCI-neoBeta2mcherry
Plasmid#45097DepositorInsertnAChR beta2 mcherry (Chrnb2 Mouse)
Tagshas c-myc tagExpressionMammalianMutationβ2 was cloned into pCI-neo at the restriction sit…PromoterCMVAvailable SinceJune 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RC(FL)
Plasmid#46864Purposeexpresses mouse IL-17RC (all exons)DepositorAvailable SinceSept. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Foxo1-ADA 6KQ
Plasmid#17563DepositorInsertFoxo1 ADA 6KQ (Foxo1 Mouse)
TagsFlag and MycExpressionMammalianMutationK242, K245, K259, K262, K271 and K291 were replac…PromoterCMVAvailable SinceOct. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-MND-B2705-SABR-Backbone
Plasmid#119051Purpose3rd gen transfer vector. HLA-B2705 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains a stuffer fragment flanked by BsmBI sites at the epitope cloning site.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 Human, EMTB is human ensconsin; TurboID is engineered BirA from E.coli)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-SHP2CS
Plasmid#12284DepositorAvailable SinceAug. 11, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG876 pDisplay-pFAST
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-SHP2DA
Plasmid#12286DepositorInsertSHP-2DA (PTPN11 Human)
TagsMycExpressionMammalianMutationAspartic Acid 425 mutated to AlanineAvailable SinceAug. 11, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAG668 lifeAct-pFAST
Plasmid#172866PurposeExpresses LifeAct-pFAST in mammalian cells (actin labeling)DepositorInsertLifeAct-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-MND-B2705-KK10-SABR
Plasmid#119053Purpose3rd gen transfer vector. HLA-B2705 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the HIV(gag) KK10 epitope "KRWIILGLNK" cloned via BsmBIDepositorInsertB2705-KK10-SABR
UseLentiviralExpressionMammalianPromoterMNDAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
LZRS-BRaf-ERTm
Plasmid#24949DepositorAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
ER-CanlonicSF
Plasmid#178343PurposeTo explore endoplasmic reticulum lactate dynamicsDepositorInsertER-CanlonicSF
TagsER Retention Signal, ER Signal Exon 1, and ER Sig…ExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-synaptoPAC-minWPRE
Plasmid#153100PurposeCre-conditional expression of synaptoPAC, a fusion of synaptophysin, mScarlet, and bPAC in neuronsDepositorInsertsUseAAVTagsHis tag, mScarlet, and myc tagExpressionMammalianAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{DTR-GFP}on-W3SL
Plasmid#111396PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation), and W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD104_Asn152Ser_pCMV6Entry-hIRG1
Plasmid#124877PurposeExpresses hCAD Asp152Ser mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated Asn152 to SerPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG671 mito-pFAST
Plasmid#172867PurposeExpresses mitochondrial targeting domain-pFAST in mammalian cellsDepositorInsertmito-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG657 H2B-pFAST
Plasmid#172862PurposeExpresses pFAST fused to zebrafish histone H2B in mammalian cellsDepositorInsertH2B-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAD64_pCMV6_Entry_hIrg1
Plasmid#124879PurposeExpresses hCAD His103Ala mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated His103 to AlaPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only