We narrowed to 4,521 results for: GCA;
-
Plasmid#77816Purpose3rd generation lentiviral gRNA plasmid targeting human IP6K2DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only
-
ARSG gRNA (BRDN0001147989)
Plasmid#77640Purpose3rd generation lentiviral gRNA plasmid targeting human ARSGDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
ANKK1 gRNA (BRDN0001149290)
Plasmid#76035Purpose3rd generation lentiviral gRNA plasmid targeting human ANKK1DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75247PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (2/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hLAMP2-C-GC6s
Plasmid#154151PurposeTo detect the calcium ion releases close to the lysosomal surfaceDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-ngRNA+41_EF1a-puroR
Plasmid#207358PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 nicking guide RNA and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 +41 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI
Plasmid#131479PurposeEndogenous tagging of βactin: N-terminal (amino acid position: D2)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST EGFP-flag-CAD
Plasmid#188118PurposeExpresses N-terminal EGFP-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsEGFP tag and Flag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST Halo-flag-CAD
Plasmid#188117PurposeExpresses N-terminal Halo-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tag and Halo tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin1 KI
Plasmid#131485PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: A20)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A S1859A
Plasmid#169826PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K, PKA, and Erk1/2 phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A S1859A; TCCC -> AGTC silent mutat…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00001
Plasmid#166718PurposesgRNA against human BAP1DepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00002
Plasmid#166719PurposesgRNA against human BAP1DepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7NT*-Bri2 113-231 R221E
Plasmid#138134PurposeExpresseds human Bri2 BRICHOS R221E mutant in E. coliDepositorInserthuman Bri2 BRICHOS R221E (ITM2B Human)
TagsNT* tag derived from spider silk proteinsExpressionBacterialPromoterT7Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_wt
Plasmid#156180PurposeCMV-driven expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterCMVAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149021)
Plasmid#77864Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001487162)
Plasmid#77925Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA1
Plasmid#99734PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat PGK1 shRNA
Plasmid#222869PurposeExpresses mTagBFP2 along with an shRNA against rat PGK1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only