We narrowed to 7,454 results for: ef1a
-
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_PP1-mCitrine
Plasmid#172472PurposeMammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.DepositorInsertprolactinSS-PP1-mCitrine (parapinopsina Zebrafish)
UseLentiviralTagsmCitrine and prolactin signal sequence (cleaved p…ExpressionMammalianPromoterEF1alphaAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-full-length-CHMP3-HA
Plasmid#154176Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGA1-EF1α-sfGFP150TAG-4xtRNA
Plasmid#251517PurposeExpression of sfGFP150TAG using the Methanomethylophilus alvus (Ma) PylRS/tRNA system for site-specific incorporation of noncanonical amino acids at TAG codons in HEK293 cellsDepositorInsertsfGFP150TAG
TagsHis6 and V5ExpressionMammalianMutation150 TAG (amino acid 150 mutated to stop codon)PromoterEF1alphaAvailable SinceMarch 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4866 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF1a in MGEV
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4207 TNFR2 NTEVp chain in PolyTX-mNeonGreen
Plasmid#244175PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, and NTEVp (75S) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
289aa Met133, 138, 186Ileu ELL2
Plasmid#127272PurposeExpresses 289aa human ELL2 with Met133, 138, 186IleuDepositorInsertELL2 w Met to ILeus stopped at XbaI (ELL2 Human)
ExpressionMammalianMutationMet133, 138, 186 Ileu, cut with XbaI blunt fillinPromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAR015 Lenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
Plasmid#195544PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBA900
Plasmid#122237PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.DepositorInsertsgRNA with cs2 at the 3' end of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300
Plasmid#191764PurposeExpression of EGFP fused to core p300 histone acetyltransferaseDepositorInsertFRB-EGFP-p300 core (EP300 Human)
TagsEGFP (N-terminal of p300 core) and FRB (N-termina…ExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4802 VEGFR2 NTEVp chain (WT NTEVp) in PolyTX-mNeonGreen
Plasmid#244173PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): VEGFR2SS-3xFLAG-VEGFR2ECD-VEGFR2TMD-NTEVp(WT)DepositorInsertMESA NTEVp chain with human VEGFR2 SS, ECD and TMD, and NTEVp (WT) (KDR Human, Synthetic)
UseSynthetic BiologyTagsVEGFR2 signal peptide - 3xFLAGExpressionMammalianPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV_iRFP_P2AT2A_mScarlet-I_Myl9
Plasmid#172474PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.DepositorInsertsUseLentiviralTagsmScarlet-IExpressionMammalianPromoterEF1alpha (with UCOE) and none (same transcript as…Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-ChBtW-dnTCF4-ires-GFP
Plasmid#133378PurposePiggybac vector for constitutive expressionDepositorInsertdnTCF4 (TCF4 Human)
Tags2x FlagExpressionMammalianMutationdeltaN31PromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAR010 Lenti pEF-dEnAsCas12a-NLS-3XHA-T2A-BSD
Plasmid#195543PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
INS-GFP-CD19-EPT
Plasmid#210469PurposeDonor plasmid for knock-in GFP-CD19 into the human INS locusDepositorInsertINS homologous recombination arms with a GFP-CD19 and EF1alpha-drived puromycin-NLS-tdTomato selection cassette (INS Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIND21-puro_SOX10-3xFLAG
Plasmid#250322PurposeTetracycline-inducible expression of SOX10. rtTA (Tet-ON) is driven by the EF1alpha promoter.DepositorAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4860 VEGFR2 NTEVp chain (75S NTEVp mutant), VEGFR1 CTEVp chain with ZF6a in MGEV
Plasmid#244188PurposeMultigene vector for constitutive expression of mNeonGreen, VEGFR2 NTEVp chain (75S NTEVp mutant), and VEGFR1 CTEVp chain with ZF6aDepositorInsertmNeonGreen; VEGFR2 NTEVp chain with NTEVp 75S mutant; VEGFR1 CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4426 IL-10Ra CTEVp chain with BATF in TUPV3
Plasmid#244195PurposeExpression of a MESA CTEVp chain encoding (N to C): IL10RaSS-3xFLAG-IL10RaECD-IL10RaTMD-CTEVp(190K)-PRS(M)-hBATFDepositorInsertMESA CTEVp chain with human IL-10Ra SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and human BATF (BATF Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4427 IL-10Ra CTEVp chain with cJun in TUPV3
Plasmid#244194PurposeExpression of a MESA CTEVp chain encoding (N to C): IL10RaSS-3xFLAG-IL10RaECD-IL10RaTMD-CTEVp(190K)-PRS(M)-hcJunDepositorInsertMESA CTEVp chain with human IL-10Ra SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and human cJun (JUN Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4219 TNFR2 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244177PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-CTEVp(190K)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EhT
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EPG
Plasmid#215545PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-siRNAresHAUS6_IRES_Blast
Plasmid#182887PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (siRNA resistant version)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianMutationsilet mutations in aa 197 - 203 to confer resista…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2 M133, 138, 186ILeu
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
ExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
IGFN1 gRNA (BRDN0001147410)
Plasmid#76823Purpose3rd generation lentiviral gRNA plasmid targeting human IGFN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IGFN1 gRNA (BRDN0001144979)
Plasmid#76824Purpose3rd generation lentiviral gRNA plasmid targeting human IGFN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IGFN1 gRNA (BRDN0001146137)
Plasmid#76825Purpose3rd generation lentiviral gRNA plasmid targeting human IGFN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IGFN1 gRNA (BRDN0001147077)
Plasmid#76826Purpose3rd generation lentiviral gRNA plasmid targeting human IGFN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1alphaAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT258 Lenti pEF-dCas9-3XFLAG-N+F+Z-T2A-tagBFP-P2A-Blast
Plasmid#187334PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-N+F+Z-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT260 Lenti pEF-dCas9-3XFLAG-VPR-T2A-tagBFP-P2A-Blast
Plasmid#187336PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-VPR-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Acly
Plasmid#70765PurposeExpresses mouse ATP-citrate lyase in mammalian cellsDepositorAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p1.1-mCherry
Plasmid#162772PurposeFluorescent reporter for CHO expression studiesDepositorInsertred fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Acly(S455D)
Plasmid#70768PurposeExpresses phosphomimetic mouse ATP-citrate lyase in mammalian cellsDepositorInsertATP Citrate Lyase (Acly Mouse)
Tagsmyc-epitopeExpressionMammalianMutationS455DPromoterEF1alphaAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Acly(S455A)
Plasmid#70767PurposeExpresses phosphomutant mouse ATP-citrate lyase in mammalian cellsDepositorInsertATP Citrate Lyase (Acly Mouse)
Tagsmyc-epitopeExpressionMammalianMutationS455APromoterEF1alphaAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJT259 Lenti pEF-dCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
Plasmid#187335PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertCas9-3XFLAG-VP64-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX_314-HRI-V5
Plasmid#202434PurposeExpression of HRIDepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only