We narrowed to 6,981 results for: Mag
-
Plasmid#39485DepositorInsertARAP3(C504A) (ARAP3 Human)
TagsEGFPExpressionMammalianMutationC504A = Arf GAP domain mutationAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5 delL116
Plasmid#246734PurposeMammalian expression of human DNAJC5 L116 deleted with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5
Plasmid#246743PurposeBacterial expression of human DNAJC5 wildtype with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialPromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 L115R
Plasmid#246745PurposeBacterial expression of human DNAJC5 L115R with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationL115RPromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 L115R
Plasmid#246742PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 delL116
Plasmid#246741PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 delL116
Plasmid#246744PurposeBacterial expression of human DNAJC5 L116 deleted with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationdelL116PromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLK06Hpp-Fab CR3009
Plasmid#239861PurposePlasmid for simultaneous Fab and GFP expression from separate Lac promoters for online monitoring of induction with a GFP sensor station. Fab is expressed as a fusion with alkaline phosphatase.DepositorInsertsTagsHexahistidine tag and bacterial alkaline phosphat…ExpressionBacterialMutationF64L, S65T, Q80R, M153T and V163APromoterLac promoterAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pME-V5-mTagBFP2-KRAS4A-WT (JDW 831)
Plasmid#242568PurposeGateway middle entry clone containing an mTagBFP2 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-WT (JDW 812)
Plasmid#242566PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-KGECO1-P2A-mGreenLantern
Plasmid#232843PurposeAAV transfer plasmid for CAG-mediated co-expression of KGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-jRGECO1-P2A-mGreenLantern
Plasmid#232844PurposeAAV transfer plasmid for CAG-mediated co-expression of jRGECO1 and mGreenLanternDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Syn-NES-SomajRGECO1a
Plasmid#232842PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted jRGECO1aDepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NONO-TFE3
Plasmid#237641PurposeFor overexpression of mEGFP-NONO-TFE3DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAMLD1-KS
Plasmid#237676PurposeFor overexpression of mEGFP-YAP-MAMLD1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NONO-TFE3-KS
Plasmid#237681PurposeFor overexpression of mEGFP-NONO-TFE3-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-Mut1
Plasmid#237647PurposeFor overexpression of mEGFP-NUP98-DDX10-Mut1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-Mut2
Plasmid#237648PurposeFor overexpression of mEGFP-NUP98-DDX10-Mut2DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-KS-FtoG
Plasmid#237645PurposeFor overexpression of mEGFP-NUP98-DDX10-KS-FtoGDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2s
Plasmid#231761PurposeExpression of mGold2s in yeast cellsDepositorInsertmGold2s
ExpressionYeastMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2t
Plasmid#231762PurposeExpression of mGold2t in yeast cellsDepositorInsertmGold2t
ExpressionYeastMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-Lifeact-mScarlet-HA-WPRE-pA (JDW 721)
Plasmid#229826PurposeTet-off, AAV vector for cre dependent expression of Lifeact mScarlet tagged with HA with EFS (minimal EF1a promoter or EF1a short/ EFS) driving destablized tTA (d2tTA)DepositorInsertmScarlet-I
UseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only