We narrowed to 7,855 results for: 11
-
Plasmid#44038DepositorAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pCW-Cdt1ΔCy-mCherry-Puro
Plasmid#193764PurposeDoxycyline-inducible (TetOn) human Cdt1ΔCy (C-terminal mCherry tag), expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertCdt1ΔCy-mCherry (CDT1 Human)
UseLentiviralTagsmCherryMutationCy motif (a.a. 68-70) mutated to alanine, a.a. 11…PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRL2 CTF-FLAG
Plasmid#217707PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRL2 (ADGRL2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-824Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3_CRKL-Y207F-V5
Plasmid#196016PurposeExpresses CRKL Y207F, V5 taggedDepositorInsertCRKL
UseLentiviralExpressionMammalianAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mcherry Gamma 9 ---pcDNA3.1
Plasmid#64203PurposeG protein Gamma cone(9) subunit tagged with mcherry on the N terminusDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSpuro shID3#1
Plasmid#19163DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 3 (ID3 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDest27-mBIN1+13
Plasmid#61087PurposeExpress N-terminal GST tagged-mouse BIN1+13 in mammalian cellsDepositorInsertmouse BIN1 with exon 13, excluding exon 7, 11, 14-17
TagsGSTExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDest27-mBIN1
Plasmid#61086PurposeExpress N-terminal GST tagged-mouse BIN1 in mammalian cellsDepositorInsertsmallest constitutive BIN1excluding exon 7, 11, 13-17
TagsGSTExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-POMP
Plasmid#86764PurposeN-terminal myc-tagged protein expression in mammalian cellsDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag‐mTim1 (Bl/6)
Plasmid#49205Purposeexpresses Flag tagged mouse Tim1DepositorInsertTim1 (BL/6 allele) (Havcr1 Mouse)
TagsFLAG and signal sequenceExpressionMammalianMutationTim1 lacks its own signal sequencePromoterEF1aAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2ΔC990
Plasmid#66946PurposeMammalian expression of rat ErbB2 ΔC990 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutationDeletion of C990. (see depositor comment below on…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2ΔC776
Plasmid#66947PurposeMammalian expression of rat ErbB2 ΔC776 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutationDeletion of C776 (see depositor comment below on …PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-PIG-Lin28b
Plasmid#64795PurposeExpresses human Lin28b in mammalian cellsDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRA3 CTF-FLAG
Plasmid#217680PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRA3 (ADGRA3 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-737Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRA2 CTF-FLAG
Plasmid#217679PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRA2 (ADGRA2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-746Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry GRK3 ct in pcDNA3.1
Plasmid#64213PurposemCherry fused between Cry2 and GRK3 ct to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1 S449A/T450A/S454A
Plasmid#19847DepositorInsertMKL1 S449A/T450A/S454A (MRTFA Human)
UseRetroviralTags3xFLAGMutationchanged Serine 449, Threonine 450 and Serine 454 …Available SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GNA11_G-alpha
Plasmid#109911PurposeProtein expression and purification of GNA11_G-alphaDepositorInsertGNA11_G-alpha (GNA11 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG eGFP-Oct4
Plasmid#203789PurposeCompetitive assay of Oct4 and Oct6 binding to DNA motifs.DepositorAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1 IntS11 AA 300-597
Plasmid#199329PurposeExpresses His-tagged Drosophila IntS11 amino acids 300-597DepositorInsertIntegrator subunit 11 (IntS11 Fly)
Tags6xHisExpressionBacterialMutationamino acids 300-597 onlyAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6
Plasmid#48812Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDest27-mBIN1+17
Plasmid#61096PurposeExpress N-terminal GST tagged-mouse BIN1+17 in mammalian cellsDepositorInsertmouse BIN1 with exon 17, excluding exon 7, 11, 13-16
TagsGSTExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-PHLDA3(wt)
Plasmid#72557PurposeHypoxia induced mutant PHLDA3. Contains the HRE from VEGF sequence (5 repeats) upstream of PHLDA3.DepositorAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,Δ42a] mut
Plasmid#26577DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, and 31b.Exons 32 and 42a a…Available SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG5 CTF-FLAG
Plasmid#217703PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG5 (ADGRG5 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-226Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRF4 CTF-FLAG
Plasmid#217697PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRF4 (ADGRF4 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-384Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRB2 CTF-FLAG
Plasmid#217682PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRB2 (BAI2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-911Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Kif5cmut
Plasmid#71854Purposemammalian expression of mutant GFP-Kif5cDepositorInsertKif5c (Kif5c Rat)
TagsEGFPExpressionMammalianMutationT93N mutation and also a novel SpeI site (1652). …PromoterCMVAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-IRES-Lin28b-P3
Plasmid#64794PurposeLuciferase expression driven by Lin28b promoter P3DepositorInsertLin28b promoter P3 (LIN28B Human)
UseLuciferaseAvailable SinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RASEFIR-HA
Plasmid#46863Purposeexpresses mouse IL-17RA with SEFIR deletionDepositorInsertIL-17RA-delta-SEFIR (Il17ra Mouse)
Tags3x HAExpressionMammalianMutationDeletion of SEFIR domain (AA 394-485)PromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1-N100 S449A/T450A/S454A
Plasmid#19849DepositorInsertMKL1-N100 S449A/T450A/S454A (MRTFA Human)
UseRetroviralTags3xFLAGMutationdeleted amino acids 1-100 and changed Serine 449,…Available SinceFeb. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
mILK-R255A/R349A-EFGP
Plasmid#176899Purposemouse ILK with R255A and R349A point mutations cloned into pEGFP-N1DepositorInsertIntegrin-linked kinase (Ilk Mouse)
TagsEGFPExpressionMammalianMutationArginine 255 to Alanine and Arginine 349 to Alani…PromoterCNVAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1_MeCP2(R111G)
Plasmid#110187PurposeExpression of mouse MeCP2 (R111G) in mammalian cellsDepositorInsertMeCP2_e2 FL [R111G] (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationArg 111 GlyPromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S449A/T450A/S454A
Plasmid#19845DepositorInsertMKL1 S449A/T450A/S454A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 449, Threonine 450 and Serine 454 …Available SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
Gal4-VP16-HSF1 WT
Plasmid#71726Purposeplasmid expressing fusion construct of Gal4 BDB VP16 AD and HSF1 WT RDDepositorInsertGal4 DBD HSF1 VP16 AD (HSF1 Human, Herpes Simplex Virus protein VP16, Budding Yeast)
ExpressionMammalianAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPPAT-11AA-2XStrep
Plasmid#125680Purposeexpresses human PPAT protein, with first 11 residues removed, with a C-terminal 2XStrep affinity tagDepositorInsertPPAT (PPAT Human)
Tags2X Strep-Tag IIExpressionMammalianMutationthe first eleven residues have been removedPromoterCMVAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
integrin beta6 777T pcDNA1 neo
Plasmid#13582DepositorInsertintegrin beta 6 777T (ITGB6 Human)
ExpressionMammalianMutation777T. Lacks last 11 amino acids of cytoplasmic do…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1_MeCP2(deltaN)
Plasmid#110189PurposeExpression of mouse MeCP2 (deltaN) in mammalian cellsDepositorInsertMeCP2_e2 delta N (mouse cDNA) _EGFP (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationdelta N terminusPromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1TCbt
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRShygro shID3#1
Plasmid#19164DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 3 (ID3 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
PET28-FnCas12a-EP16
Plasmid#183636PurposePET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.DepositorInsertFnCas12a-EP16
UseCRISPRTags6×His TagExpressionBacterialMutationN607R, K613V, N617R, K180S, K660R, D616NAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry NEDD4 WW2 pos ctrl
Plasmid#112029PurposeMode #2 phosphosite positive control (split mCherry, using NEDD4 WW2 binding domain paired with proline-rich positive control peptide)DepositorInsertNEDD4 WW2 domain fused to C-terminal split mCherry, proline-rich pos ctrl interacting peptide fused to N-terminal split mCherry
TagsSplit mCherryExpressionBacterialAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3
Plasmid#48811PurposeThis report is the first to directly measure nAChR subunit stoichiometry using FRET and plasma membrane localization of α6- and β3-containing receptors using TIRF.DepositorAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIKAT111
Plasmid#69996PurposeMammalian expression of cytochrome p450 CYP2B6 variantDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRR.6
Plasmid#69997PurposeMammalian expression of cytochrome p450 CYP2B6 variantDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only