We narrowed to 42,665 results for: cha;
-
Plasmid#183530PurposeOptogeneticsDepositorInserthsChRmine-eYFP
UseAAVTagsExpressionMutationH33RPromoterCaMKIIaAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_deltaLC
Plasmid#98664PurposeExpresses MBP-tagged hnRNPA2 without the LC domainDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHis-MBPExpressionBacterialMutationG190StopPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-miRFP670-Cry2WT
Plasmid#122441PurposeExpresses disordered protein FUS(1-214) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertFUS (FUS Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationContains only amino acids 1-214PromoterSFFVAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_D290V
Plasmid#98663PurposeExpresses MBP-tagged full length hnRNPA2 with D290VDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTags6xHis-MBPExpressionBacterialMutationD290VPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_P298L
Plasmid#104468Purposeexpress MBP-tagged full length hnRNPA2 P298LDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsHis-MBPExpressionBacterialMutationP298LPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB(C460S)
Plasmid#183677PurposeRecombinant Salmonella Typhimurium SopB (catalytically inactive)DepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium, Budding Yeast)
UseTagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialMutationC460SPromoterT7Available sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-li-p33_RS-CLIP
Plasmid#104634PurposeHuman Invariant chain with a CLIP replacement with in frame restriction sites (KpnI/XhoI)DepositorInsertmodified Invariant chain p33 (CD74 Human)
UseEntry vector for gateway systemTagsnoneExpressionMutationCLIP domain was replaced by 2 restriction sitesPromoterAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
UseTagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGExpressionMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xnr UAS ifgMosaic Donor vector (IG230)
Plasmid#99631PurposeTo clone the 3 ORFs for Gal4 dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWp28-v1 scaffold
Plasmid#157976PurposepBT264-U6p-{2xBbsI}-v1 sgRNA scaffold-{MfeI} Note: This plasmid is unstable. Screen multiple colonies to identify full length clones.DepositorTypeEmpty backboneUseTagsExpressionMutationPromoterAvailable sinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE MDproER
Plasmid#13495DepositorUseRetroviralTagsExpressionMammalianMutationfull length MyoD (containing the point mutation A…PromoterAvailable sinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
Triple ORF FRT ifgMosaic Donor (IG135)
Plasmid#99626PurposeTo clone the 3 ORFs for FlpO dependent generation of ifgMosaicsDepositorInsertPGK-Neo
UseCre/Lox, Mouse Targeting, and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Strep-His-Tev-hCGNL1
Plasmid#236520PurposeFor expression of Paracingulin (human) in insect cellsDepositorInsertCGNL1 (CGNL1 Human)
UseTags2xStrep-10xHis-TevExpressionInsectMutationWTPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-cCGNL1-Myc
Plasmid#236516PurposeFor expression of Paracingulin (dog) in mammalian cellsDepositorInsertCGNL1 (CGNL1 Canis lupus familiaris (dog))
UseTagsGFP and MycExpressionMammalianMutationWTPromoterAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 C100A-WPRE-UbC-Emerald
Plasmid#225949PurposeLentiviral vector plasmid expressing human CKAP4 mutation C100A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationC100APromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 CC-WPRE-UbC-Emerald
Plasmid#225950PurposeLentiviral vector plasmid expressing human CKAP4 mutation double cysteine (CC) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationAdditional cysteine inserted after Cys-100PromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN4-WPRE-UbC-Emerald
Plasmid#225938PurposeLentiviral vector plasmid expressing human reticulon 4 (RTN4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM2-WPRE-UbC-Emerald
Plasmid#225940PurposeLentiviral vector plasmid expressing human stromal interaction molecule 2 (STIM2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2a_(CJT91)
Plasmid#226991PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2a must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2a to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AtSLAC1 8D
Plasmid#212948PurposeVector used for expression of AtSLAC1 8D in mammalian cellDepositorInsertSlow anion channel-associated 1 (OZS1 Mustard Weed)
UseTagsExpressionMammalianMutationS59D/T62D/S65D/S86D/S107D/S124D/S146D/S152DPromoterCMVAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Bn R52A, R54A pMT2
Plasmid#206087PurposeCav2.2 N-terminus (amino acids 1-95) with R52A and R54A mutations that prevent dominant-negative suppression of Cav2.2 currents by truncated Cav2.2DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationR52A, R54APromoterAd MLP/TPL/SV40Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only