We narrowed to 7,455 results for: Trac
-
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)
Plasmid#174642PurposeOptogenetic coupling to tetramerized moss kinesin-14 via SSPB(micro) for highly efficient retrograde transportDepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)
TagsSSPB(micro)-VenusExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-AP-His
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-500
Plasmid#19839DepositorInsertMKL1 D444-500 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-500Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
Plasmid#173865PurposeMammalian expression of mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax (opto-Rac1)DepositorInsertmVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mVenusExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 T450A
Plasmid#19843DepositorInsertMKL1 T450A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Threonine 450 to AlanineAvailable SinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc p31Comet
Plasmid#59833PurposeAllows the integration of myc p31Comet in the genome and Tet-inducible expression.DepositorInsertp31 (MAD2L1BP Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-GFP
Plasmid#72897PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and GFPDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-GFP
TagsIRES-GFPExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D500-630
Plasmid#19841DepositorInsertMKL1 D500-630 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 500-630Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D381-506
Plasmid#19853DepositorAvailable SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 HA-TSPAN12^11-LEL
Plasmid#115785PurposeExpresses a chimera in mammalian cells: the large extracellular loop of TSPAN12 is replaced with TSPAN11 sequenceDepositorTagsHAExpressionMammalianMutationlarge extracellular loop of TSPAN12 replaced with…PromoterCMVAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD53
Plasmid#172457PurposeExpression of Tumor Protein D52 like 1 (TPD53/TPD52L1) with N-terminal mCherry-FKBP tagDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Myc-delta/gamma2SIL
Plasmid#119731PurposeGABAA receptor expression (chimeric rat delta subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat gamma 2 short subunit) Myc-tag near N-terminusDepositorTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAV10.F6.loxP
Plasmid#63201PurposepCACS backbone (Amp), KlURA3, contains an RFP flanked by BsaI sites with CAGT & TTTT overhangs for TU assembly using yGG. LoxP flanked TU. Integration into chrVI: 97873-98803 (NotI or BciVI).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastAvailable SinceOct. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 L272A
Plasmid#19850DepositorInsertMKL1 L272A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Leucine 272 to AlanineAvailable SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-630
Plasmid#19840DepositorInsertMKL1 D444-630 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-630Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S449A
Plasmid#19842DepositorInsertMKL1 S449A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 449 to AlanineAvailable SinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only