We narrowed to 11,444 results for: nar
-
Plasmid#60365PurposePlasmid for expression of bacterial RNase HI tagged with NLS-mCherry that can be used to degrade R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI
TagsNLS from SV40 T antigen and mCherryExpressionMammalianPromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-B/c
Plasmid#199559PurposeGATEWAY-compatible entry vectorDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 N-T2A-M-IRES-E
Plasmid#231903PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '3-plasmid' systemDepositorExpressionMammalianMutationR203M in N proteinPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-PolB(T304I)-Puro
Plasmid#177143PurposeLentiviral vector expressing Flag-PolB(T304I) and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
enDR3-TEV-mEGFP-NLS (pRS1451)
Plasmid#240546PurposeExpression of the engineered N-terminal hybrid-binding domain of RNase H3 (enDR3) for capturing R-loops. A TEV cleavage site, mEGFP and nuclear localization signal (NLS) are included in the fusion.DepositorInsertenDR3
ExpressionMammalianMutationL52MAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
nb-enDR3-TEV-mEGFP-NLS (pRS1458)
Plasmid#240547PurposeExpression of negative control for R-loops capture experiments using enDR3. A mutated, non-R-loops binding version of enDR3 is expressed in fusion with the TEV cleavage site, mEGFP, and NLS.DepositorInsertnb-enDR3
ExpressionMammalianMutationS48A, K50AAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMA7-SacB
Plasmid#79968PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
Levansucrase
UseSynthetic BiologyExpressionBacterialPromoterpBADAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRL_GI_PCB28
Plasmid#98745PurposeFor phycocyanobilin production in Saccharomyces cerevisiae. Contains integrative cassette for the yeast his1-Δ200 locus. Encodes constitutively expressed HY1 and PcyA.DepositorInsertsUseSynthetic BiologyExpressionYeastMutationCodon optimized for Saccharomyces cerevisiaePromoterADH1m and PGK1Available SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
WN10150
Plasmid#80443PurposeExpresses dead (908A) AsCpf1DepositorInsertnuclease dead (908A) AsCpf1
TagsNLS-3xHAExpressionMammalianMutationnuclease dead (D908A)Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hCdt1-HA
Plasmid#117500PurposeExpresses human Cdt1 fused to HA tagDepositorInsertCdc10-dependent transcript-1 (CDT1 Human, 1700 bp)
TagsHAExpressionMammalianMutationwild-typePromoterCMVAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Cell-cycle
Plasmid#206280PurposeExpression of a FUCCI cell cycle sensor with a H2B iRFP713 chromatin reporter. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B iRFP713, mAG-hGeminin, mKO2-hCdt1
UseRecombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot7-D40AE42A_L
Plasmid#146890PurposeMammalian Expression of HsNot7-D40AE42A. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-eIF4E K119A
Plasmid#112818PurposeExpresses N-terminally GST-tagged mouse Eif4e K119A in bacterial cellsDepositorInsertEif4e (Eif4e Mouse)
TagsGSTExpressionBacterialMutationK119 mutated to A, increasing affinity for cap st…PromoterT7Available SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only