We narrowed to 9,360 results for: CAG
-
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pPN273
Plasmid#91644PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
NSL1 C6.4 gRNA
Plasmid#90805Purpose3rd generation lentiviral gRNA plasmid targeting human NSL1DepositorInsertNSL1 (Guide Designation C6.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MTCH2 D4.3 gRNA
Plasmid#90775Purpose3rd generation lentiviral gRNA plasmid targeting human MTCH2DepositorInsertMTCH2 (Guide Designation D4.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
DLGAP5 D1.4 gRNA
Plasmid#90654Purpose3rd generation lentiviral gRNA plasmid targeting human DLGAP5DepositorInsertDLGAP5 (Guide Designation D1.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CHEK1 C2.2 gRNA
Plasmid#90627Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK1DepositorInsertCHEK1 (Guide Designation C2.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
ELAVL1 E6.3 gRNA
Plasmid#90679Purpose3rd generation lentiviral gRNA plasmid targeting human ELAVL1DepositorInsertELAVL1 (Guide Designation E6.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZWILCH H11.1 gRNA
Plasmid#90945Purpose3rd generation lentiviral gRNA plasmid targeting human ZWILCHDepositorInsertZWILCH (Guide Designation H11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
BUB1 A5.1 gRNA
Plasmid#90552Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorInsertBUB1 (Guide Designation A5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_1
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG-P2A-nUnaG-ST-P2A-mCh
Plasmid#207634PurposeA plasmid encoding photocaged SpyCatcher (pSC)-cUnaG, nUnaG-SpyTag (ST), and mCherry separated by P2A cleaving sequences for mammalian expression.DepositorInsertphotocaged SpyCatcher-cUnaG-P2A-nUnaG-SpyTag-P2A-mCh
ExpressionMammalianMutationAmber stop codon at SC's critical lysinePromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pColdI-SBP-eIF4A1
Plasmid#233621PurposeExpression of SBP-tagged eIF4A1 in E.coliDepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PRKAG3 gRNA (BRDN0001146704)
Plasmid#77294Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPHK1 gRNA (BRDN0001148403)
Plasmid#76815Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-CEP135
Plasmid#227286PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CEP135 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CEP135 (CEP135 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
rAAV-U6-MeCP2shRNA-CamKIIa-mCherry
Plasmid#169704PurposeMeCP2 KnockdownDepositorInsertshRNA against MeCp2 (Mecp2 Mouse)
UseAAVAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_1
Plasmid#215236PurposeSupression of shcircHUWE1(19,20)_1 expressionDepositorInsertcircHUWE1 shRNA 1 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TNIK gRNA (BRDN0001146045)
Plasmid#75849Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/empty
Plasmid#105505PurposeEmpty backbone of MSCV-driven retroviral cDNA expressionDepositorTypeEmpty backboneUseRetroviralAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pSC-mCh-P2A-ST-EGFP-CAAX
Plasmid#207636PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to mCherry and a SpyTag-EGFP localized to the cell membrane via CAAX tagDepositorInsertphotocaged SpyCatcher-mCh-P2A-SpyTag-EGFP-CAAX
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only