We narrowed to 3,846 results for: 28
-
Plasmid#87867PurposeExpress a wild type human Atg7/Apg7 in mammalian cellsDepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pHSP90(G97D)-mOFP
Plasmid#228195Purposeexpressed human Hsp90 (G97D mutation) with a mOFP fluorescent protein tagDepositorInsertHSP90AA1(G97D) (HSP90AA1 Human)
TagsmOFPExpressionMammalianMutationG97D mutationPromoterCMVAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-MND-A0201-Mart1-SABR
Plasmid#119052Purpose3rd gen transfer vector. HLA-A0201 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the Mart1 epitope "ELAGIGILTV" cloned via BsmBIDepositorInsertA0201-Mart1-SABR
UseLentiviralExpressionMammalianPromoterMNDAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαs-LgB113
Plasmid#134362PurposeNanoluc complementation assay. Expression of Gαs protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 113 and 114 of Gαs. Addition of the HA epitope at N terminus of Gαs.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi3-LgB91
Plasmid#134359PurposeNanoluc complementation assay. Expression of Gαi3 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi3. Addition of the HA epitope at N terminus of Gαi3.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi2-LgB91
Plasmid#134358PurposeNanoluc complementation assay. Expression of Gαi2 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi2. Addition of the HA epitope at N terminus of Gαi2.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM_H3.2-HaloTag
Plasmid#244240PurposeCRISPR/Cas9 donor plasmid to tag human histone H3.2 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMNZ-neo-Flag-TNFR1 L380A
Plasmid#43949DepositorAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-cTNT-Cre
Plasmid#209785PurposeExpresses Cre by the specific cTNT promoterDepositorInsertCre
UseAAVPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBMN-neo-Flag-TNFR1 L380A Del229-244
Plasmid#44098DepositorInserthuman tumor necrosis factor receptor 1 (TNFRSF1A Human)
UseRetroviralTagsFlagMutationL380AAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1b in pT3TS-Dest
Plasmid#194295PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1b from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LACDepositorInsertcavin1b (cavin1b Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc UNC119B
Plasmid#128333PurposeMammalian expression vector of Myc-tagged human UNC119BDepositorAvailable SinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LAP2 Full I pAcGFP-N1 monomeric GFP (1317)
Plasmid#62044Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA-PHLPP1 full length
Plasmid#37100PurposeExpresses HA tagged, full-length human PHLPP1 in mammalian cellsDepositorAvailable SinceOct. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMCP-Luc (MCP-1 promoter in pGL3-basic)
Plasmid#40324DepositorInsertMCP-1 promoter (Ccl2 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationcontains MCP-1 promoter region through the nucleo…PromoterMCP-1Available SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA-G83I
Plasmid#191239PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA-G83I and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and Glycin…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huLbCpf1
Plasmid#90096PurposeBacterial expression plasmid for protein purificationDepositorInserthuLbCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Abi1
Plasmid#74905PurposeExpresses human Abi1 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only