We narrowed to 11,210 results for: nar
-
Plasmid#106414PurposeCo-expresses trans SNARE complex with pDC183 in E.coliDepositorInsertsTagsHis tagExpressionBacterialMutationFragment 191-256 , Codon optimization and Fragmen…PromoterT7Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mNRDc-E>A-V5
Plasmid#51298Purposeexpression of the inactive mutant of mouse NRDc in mammalian cellsDepositorInsertNRDc E247A (Nrd1 Mouse)
TagsHIS and V5ExpressionMammalianMutationE247A, enzymatic inactive mutantPromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBTK614
Plasmid#110608PurposeBTK assembled plasmid - Encodes dCas9 with no targeting sgRNA (used in Stage 2 assembly to repress target genes)DepositorInsertdCas9
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK601
Plasmid#110607PurposeBTK assembled plasmid - encodes Cas9 with no targeting sgRNA (used with suicide plasmid for broad-host-range genome alteration)DepositorInsertCas9
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB119
Plasmid#68573PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJM529 EF1α 3xFLAG-NLS-DsDed-intC-ZF10-NLS-HA in TUPV5
Plasmid#161555PurposeConstitutive expression of 3xFLAG-NLS-DsDed-intC-ZF10-NLS-HA under the EF1α promoterDepositorInsert3xFLAG-NLS-DsDed-intC-ZF10-NLS-HA
UseSynthetic BiologyTags3x-FLAG and HAExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Akt1(D323A/D325A)
Plasmid#86630PurposeExpresses eGFP-tagged human Akt1(D323A/D325A) mutantDepositorInsertAkt1(D323A/D325A) (AKT1 Human)
ExpressionMammalianAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB321
Plasmid#68649PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-PH-citrine
Plasmid#131406PurposePurpose: synthesis of mRNA encoding a membrane marker. Insert: PH domain of the human phospholipase C delta 1 (PLCD1) fused with the yellow fluorescent protein mCitrineDepositorInsertPH
UseIn vitro transcriptionTagscitrine yellow fluorescent proteinPromoterT7Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDC183
Plasmid#106415PurposeCo-expresses trans SNARE complex with pQZ210 in E. coliDepositorInsertsExpressionBacterialMutationFragment 141-204, Codon optimization and Fragment…PromoterT7Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB121
Plasmid#68575PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFBD-Akt1(T308A/S473A)
Plasmid#86578PurposeExpresses human full-length Akt1(T308A/S473A) phosphomutantDepositorAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX-B3omega2 (GB1695)
Plasmid#160644PurposepLX series: pBBR1-based T-DNA binary vector for plant transformation (omega2)DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX-B2alpha2 (GB1696)
Plasmid#160620PurposepLX series: pBBR1-based T-DNA binary vector for plant transformation (alpha2)DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pHR-FRB:Akt1(D274A)
Plasmid#86634PurposeExpresses FRB-tagged human Akt1(D274A) kinase-inactive mutantDepositorInsertFRB-Akt1(D274A) (AKT1 Human)
ExpressionMammalianAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):dTomato:IRES:Puro
Plasmid#110831PurposeExpresses both zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter, where the fluorescent dT reporter is fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-PH1(K14A)
Plasmid#86600PurposeExpresses mCherry-tagged PH(K14A) domain of human Akt1DepositorInsertK14A mutant of Akt1 PH domain (AKT1 Human)
ExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB222
Plasmid#68613PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB219
Plasmid#68610PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFBD-Akt1(K14A)
Plasmid#86562PurposeExpresses human full-length Akt1(K14A) mutantDepositorAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEH60 Lamp2b MS2 HA
Plasmid#168209PurposeMammalian expression of lysosome-associated membrane protein 2b fused to the MS2 dimer and C-terminal HA tagDepositorAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgHAL
Plasmid#102315Purposegenetic depletion of HALDepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB221
Plasmid#68612PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB319
Plasmid#68647PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger1-TS-YFP)
Plasmid#127245PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger3-TS-YFP)
Plasmid#127242PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgFTCD_1
Plasmid#102312Purposegenetic depletion of FTCDDepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only