We narrowed to 10,688 results for: AGA
-
Plasmid#58250PurposeRetroviral expression vector encoding an empty IRES-Puromycin cassetteDepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only
-
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc UNC119Aa
Plasmid#128331PurposeMammalian expression vector of Myc-tagged human UNC119A isoform aDepositorInsertUNC119 (UNC119 Human)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP
Plasmid#61527PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc UNC119Ab
Plasmid#128332PurposeMammalian expression vector of Myc-tagged human UNC119A isoform bDepositorInsertUNC119 (UNC119 Human)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Retro-Puro-Drp1-shRNA
Plasmid#99385PurposeExpresses shRNA against human Drp1 from puromycin resistance retroviral vectorDepositorInsertDynamin-1-like protein (DNM1L Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K(S441A/S445A)
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
UseTagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-FLAG-AU1
Plasmid#162117PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-FLAG-AU1
UseLentiviralTagsProtC-FLAG-AU1ExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-HA-AU1
Plasmid#162107PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1ExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-FLAG-AU1
Plasmid#162108PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-FLAG-AU1
UseLentiviralTagsVSVg-FLAG-AU1ExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-FLAG
Plasmid#162112PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-ProtC-FLAG
Plasmid#162084PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-ProtC-FLAG
UseLentiviralTagsVSVg-ProtC-FLAGExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-HA
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-AU1
Plasmid#162091PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1ExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAExpressionMutationWTPromoterEF1AAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHRIG-AktDN
Plasmid#53597Purposelentiviral expression of dominant negative mouse Akt1 and EGFPDepositorInsertAkt1 (Akt1 Mouse)
UseLentiviralTagsHA and IRES-EGFPExpressionMammalianMutationDominant negative (K179M)PromoterCMVAvailable sinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP(TA)
Plasmid#61528PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TA mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TA mutation (see comments) and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1b2 (273-586)
Plasmid#162733PurposeBacterial expression the b1b2 tandem domains from the rat Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1b2 domains (residues 273-586)
UseTags6HisExpressionBacterialMutationCodon optimisedPromoterAvailable sinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAPM-miR30-IFIH1-ts2
Plasmid#174260PurposeIFIH1 knockdownDepositorInsertIFIH1 shRNA (IFIH1 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorUseTagsExpressionBacterialMutationpartial genomicPromoterAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCRISPR Human CASP9 -2
Plasmid#198420PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianMutationPromoterU6; CMVAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PHD2
Plasmid#223552PurposeLentivirus transfer plasmid for expression of full length human PHD2DepositorInsertPHD2 (EGLN1 Human)
UseLentiviralTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry KNL1 wt hardened and RVSF->AAAA
Plasmid#45226DepositorInsertmCherry KNL1 with RVSF-AAAA mutation, resistant to KNL1 siRNA (KNL1 Human)
UseTagsTEV S15ExpressionMutationRVSF 58 AAAAPromoterAvailable sinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
UseTagsExpressionMammalianMutationPromoterHuman U6Available sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBRY-nuclear mCherry-IRES-PURO
Plasmid#52409PurposeConstitutively expressed mammalian expression vector encoding nuclear mCherry fluorescent reporter. Puromycin resistance.DepositorInsertnuclear mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralTagsExpressionMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only