We narrowed to 8,543 results for: sgrna
-
Plasmid#186940PurposeH3f3a KO in mouse ES cellsDepositorInsertH3f3a KO sgRNA (H3f3a Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-H3f3b KO sgRNA
Plasmid#186941PurposeH3f3b KO in mouse ES cellsDepositorInsertH3f3b KO sgRNA (H3f3b Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_VEGFA-mcherry
Plasmid#159790PurposeS. pyogenes sgRNA collocated with pegRNA targeting human VEGFA geneDepositorInsertspacer of sgRNA targeting VEGFA gene (VEGFA Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionWormMutationPromoterrpr-1 promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2842C
Plasmid#139324PurposePlasmid expressing a sgRNA to introduce BRCA2 R2842C using base editingDepositorInsertsgRNA to insert BRCA2 R2842C using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-eSpCas9-sgRNA
Plasmid#179580PurposeExpresses eSpCas9 and gRNA that targets ColE1 plasmids for curingDepositorInserteSpCas9
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human T (BRACHYURY) sgRNA
Plasmid#59726PurposePlasmid encoding sgRNA to generate T (BRACHYURY) knock-out mutant human cellsDepositorInserthT sgRNA (TBXT Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPsgRNA
Plasmid#126610PurposeExpresses CNP sgRNA under mouse U6 promoterDepositorInsertCNP sgRNA (Cnp Mouse)
UseCRISPRTagsExpressionMutationPromotermouse U6 promoterAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_sgRNA
Plasmid#68422PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertGluc sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA1
Plasmid#102857PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA2
Plasmid#102858PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA1 (UFSP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human SOX17 sgRNA
Plasmid#59725PurposePlasmid encoding sgRNA to generate SOX17 knock-out mutant human cellsDepositorInserthSox17 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_EMX1-mcherry
Plasmid#159784PurposeS. pyogenes sgRNA collocated with pegRNA targeting human EMX1 geneDepositorInsertspacer of sgRNA targeting EMX1gene (EMX1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_HOXD13-mcherry
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human BLIMP1 sgRNA
Plasmid#59724PurposePlasmid encoding sgRNA to generate BLIMP1 knockout mutant human cellsDepositorInserthBLIMP1 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 1
Plasmid#70652PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
px459-Rheb sgRNA
Plasmid#133768PurposeExpresses Cas9 and human Rheb sgRNADepositorInsertRheb sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorInsertTZAP (ZBTB48 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterH1Available sinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA1 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA2 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNS1D-sgRNA9-SpR
Plasmid#191092PurposeaTc inducible gRNA expression plasmid with BbsI sites for Golden Gate insertion of crRNA oligos and homology arms for genome integration at NS1D in Synechococcus sp. PCC 7002DepositorTypeEmpty backboneUseCRISPRTagsExpressionBacterialMutationPromotertetAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorInsertsgRNA targeting GLB1 (GLB1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only