We narrowed to 23,118 results for: Sis
-
Plasmid#238341PurposeproUBI10::VIH2-FL::FLAG-K379A-K381A-K498A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
NST3_pOpOn2.1
Plasmid#228066PurposeExpresses NST3 in different cell types in Arabidopsis thaliana upon induction with dexamethasone.DepositorInsertNAC SECONDARY WALL THICKENING PROMOTING FACTOR3, NST3 (NAC012 Mustard Weed)
UseDexamethasone inducible vectorExpressionPlantPromoterCaMV35S for LhGR and pOp6-minimal CaMV35S for NST3Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1-R249E-R289E-R296E
Plasmid#159532PurposeExpresses Arabidopsis thaliana VERNALIZATION1 mutant, with R249E, R289E and R296E mutations, in E. coliDepositorInsertVERNALIZATION1 (VRN1 Mustard Weed)
TagsSix-Histidine tagExpressionBacterialMutationThree charge reversal mutations, namely R249E R28…PromoterT5Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
plx304-PHB-V5
Plasmid#122230PurposeExpresses human PHB attached to a V5 tagDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) eGFP
Plasmid#107505PurposeExpresses eGFP, puromycin resistantDepositorInserteGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGem-sHyper:sAPX
Plasmid#84738PurposeSimultaneous expresion of stromal sHyPer and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterpFMV/p35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer:sAPX
Plasmid#84735PurposeSimultaneous expresion of stromal HyPer2 and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterFMV/35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10::ZF2CACTA1_3xFLAG_TET1cd
Plasmid#106433PurposepUBQ10 driven Zinc Finger human TET1 catalytic domain fusion that targets the CACTA1 promoter in arabidopsisDepositorInsertpUBQ10::ZF1CACTA1_3xFLAG_TET1cd (TET1 Human, Mustard Weed, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionPlantAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pW210-pPB-GA-inducible-CRISPRa-sa_dCas9-VPR-hygR
Plasmid#170808PurposePiggyBac vector to express GA-inducible VPR-Sa_dCas9 with hygromycin resistanceDepositorInsertsExpressionMammalianMutationSynonymous mutation in PYL1 to remove XhoI site (…Available SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) FITM2
Plasmid#107504PurposeExpresses FITM2, puromycin resistantDepositorInsertFITM2 (codon optimized)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ERECTA C6_pECIA2
Plasmid#115127PurposeBait vector ERECTA C6_pECIA2 should be used with prey vector ERECTA C6_pECIA14.DepositorInsertAT2G26330 (ER Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERECTA C6_pECIA14
Plasmid#114927PurposePrey vector ERECTA C6_pECIA14 should be used with bait vector ERECTA C6_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK2 P5_pECIA2
Plasmid#114968PurposeBait vector SERK2 P5_pECIA2 should be used with prey vector SERK2 P5_pECIA14.DepositorInsertAT1G34210 (SERK2 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
GHR1 X017_pECIA14
Plasmid#114847PurposePrey vector GHR1 X017_pECIA14 should be used with bait vector GHR1 X017_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MDIS2/MRH1 P1_pECIA14
Plasmid#114839PurposePrey vector MDIS2/MRH1 P1_pECIA14 should be used with bait vector MDIS2/MRH1 P1_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK2 P5_pECIA14
Plasmid#114768PurposePrey vector SERK2 P5_pECIA14 should be used with bait vector SERK2 P5_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana PARP2
Plasmid#175810PurposepENTR4 plasmid with CDS of Arabidopsis thaliana POLY(ADP-RIBOSE) POLYMERASE 2 (PARP2, AT4G02390.1) without stop codon for C-terminal epitope tagsDepositorAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) SDC3
Plasmid#107501PurposeExpresses SDC3, puromycin resistantDepositorInsertSDC3 (codon optimized) (SDC3 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) PHLDB1
Plasmid#107503PurposeExpresses PHLDB1, puromycin resistantDepositorInsertPHLDB1 (PHLDB1 Human)
UseLentiviralExpressionMammalianMutationNucleotide changes 1236 T>C, 1365 C>T, 1371…PromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) MXRA7
Plasmid#107500PurposeExpresses MXRA7, puromycin resistantDepositorInsertMXRA7 (codon optimized) (MXRA7 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) VOPP1
Plasmid#107507Purposeexpressing VOPP1, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_LUP1
Plasmid#103857PurposeHeterologous, cobalt-inducible expression of SQE1 and LUP1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertlupeol synthase 1 (LUP1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-8
Plasmid#122233PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-4
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) RALB
Plasmid#107506PurposeExpressing RALB, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK3/BAK1 BAKNcFus_pECIA14
Plasmid#114775PurposePrey vector SERK3/BAK1 BAKNcFus_pECIA14 should be used with bait vector SERK3/BAK1 BAKNcFus_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana IMPORTIN ALPHA 3 / MOS6
Plasmid#175820PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 3 / MOS6, lacks start ATG and includes stop codon for N-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 3 (MOS6 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnonePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) TSPAN9
Plasmid#107502PurposeExpresses TSPAN9, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C
Plasmid#89717PurposeLentiviral gene expression vector for doxycycline inducible MEF2C expressionDepositorAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) IGF1R
Plasmid#107499PurposeExpresses IGF1R, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C
Plasmid#89715PurposeRetroviral gene expression vector for MEF2C expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) EPB41L1
Plasmid#107508PurposeExpressing EPB41L1, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C S222A
Plasmid#89718PurposeLentiviral gene expression vector for doxycycline inducible MEF2C-S222A expressionDepositorInsertMEF2C (MEF2C Human)
UseLentiviralExpressionMammalianMutationChanged serine 222 to alanineAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) FAM149A
Plasmid#107510PurposeExpressing FAM149a, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) CRIP2
Plasmid#107509PurposeExpressing CRIP2, puromycin resistantDepositorInsertCRIP2 (codon optimized) (CRIP2 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only