We narrowed to 5,107 results for: PEP
-
Plasmid#27546PurposeLentiviral bicistronic co-expression of Cre and mCherry; linked by a P2A peptide.DepositorInsertmCherry_P2A_Cre recombinase
UseCre/Lox and LentiviralTagsExpressionMutationPromoterCMVAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B7
Plasmid#135509PurposeMammalian expression of myc-tagged HLA-B*07:02DepositorInsertHLA-B*07:02 (HLA-B Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYCN_P2A_Hygro_Barcode
Plasmid#120463PurposeBarcoded lentiviral vector to express MYCN in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYCN (MYCN Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D BARK p2A mCherry
Plasmid#117691PurposeGfaABC1D-iBARK-p2A-mCherry: Viral expression vector for astrocyte Gaq silencingDepositorInsertBARKrgs peptide
UseAAVTagsHA / FLAGExpressionMutationPromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
8522-M01-663
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralTagsExpressionMutationPromoterSORE6-mCMVpAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-mCherry-CDMPR
Plasmid#182643PurposeMammalian expression vector encoding a protein fusion composed of an N-terminal ER targeting sequence of hemagglutinin (HA), followed by mCherry and murine CDMPR (without its signal peptide)DepositorInsertCDMPR
UseRetroviralTagsN-terminal ER targeting sequence of hemagglutinin…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-EGFP-CDMPR
Plasmid#182642PurposeMammalian expression vector encoding a protein fusion composed of an N-terminal ER targeting sequence of hemagglutinin (HA), followed by EGFP and murine CDMPR (without its signal peptide)DepositorInsertCDMPR
UseRetroviralTagsEGFP and N-terminal ER targeting sequence of hema…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-C3-10H-SIII
Plasmid#175444PurposeHiFi-compatible destination vector for secreted overexpression of 3C-cleavable, C-terminal 10His-TwinStrep tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneUseTags3C-10His-TwinStrep and BiP Secretion PeptideExpressionInsectMutationPromoterFused Actin-HSP70Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
OPRM1-DuET
Plasmid#213361PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertOPRM1 (OPRM1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAG FLEX BARK p2A mCherry
Plasmid#117693PurposeCAG-FLEx-iBARK-p2A-mCherry: Viral expression vector for Cre-dependent Gaq silencingDepositorInsertBARKrgs peptide
UseCre/LoxTagsHA / FLAGExpressionMutationPromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI-Caspase 1
Plasmid#41552DepositorInsertCaspase-1 (CASP1 Human)
UseTagsMycExpressionMammalianMutationPromoterCMV immediate-early enhancer/promoterAvailable sinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianMutationPromoterCbhAvailable sinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-Cre-2A-mCherry-FKF
Plasmid#119868PurposeDonor cassette containing NLS-tagged Cre, a Thosea asigna virus peptide (2A), mCherry and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertNLS-Cre, 2A, mCherry and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
UseTagsmCherryExpressionBacterialMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
P2RY11-DuET
Plasmid#213364PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertP2RY11 (P2RY11 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR
Plasmid#135500PurposeMammalian expression of FLAG-tagged TAPBPRDepositorInsertTAPBPR (TAPBPL Human)
UseTagsLuminal FLAG epitope tag and Signal peptide from …ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 1475 (pLenti-BLAST-GATA4-P2A-H2A-mCherry)
Plasmid#233549PurposeA CMV driven human GATA4 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorInsertGATA4 (GATA4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HA-Flag-natT1R2
Plasmid#113944Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839PromoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-AP-Sstr3-GFP-DEST
Plasmid#49098PurposeExpressing AP-Sstr3-GFP in mammalian cells, can be used for establishing Flp-In stable cell linesDepositorInsertSstr3 (Sstr3 Mouse)
UseTagsGFP and acceptor peptide (AP)ExpressionMammalianMutationPromoterT7Available sinceNov. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
UseTags(His)6 and EGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only