We narrowed to 8,543 results for: sgrna
-
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 2
Plasmid#207608PurposesgRNA 2 for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertacccccaaacctgactgact
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA
Plasmid#191528PurposeVector for tandem expression of SLBP 3'UTR G1 sgRNA in combination with ATP1A1 G3 sgRNA from two independent U6 promoters to facilitate SLBP endogenous tagging by marker free coselection using ouabainDepositorInsertSLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-CRY2-#1
Plasmid#189989PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hCRY2, works with Addgene 189983-189986DepositorInsertCryptochrome-2 (CRY2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1 _8xCTS-ECFP-pA
Plasmid#200243PurposeMammalian transfections; 8xCTS-ECFP reporter construct 1DepositorInsertsgRNA1_8xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1 _1xCTS-ECFP-pA
Plasmid#200237PurposeMammalian transfections; 1xCTS-ECFP reporter construct 1DepositorInsertsgRNA1_1xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA5 _1xCTS-ECFP-pA
Plasmid#200241PurposeMammalian transfections; 1xCTS-ECFP reporter construct 5DepositorInsertsgRNA5_1xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3 _1xCTS-ECFP-pA
Plasmid#200239PurposeMammalian transfections; 1xCTS-ECFP reporter construct 3DepositorInsertsgRNA3_1xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4 _1xCTS-ECFP-pA
Plasmid#200240PurposeMammalian transfections; 1xCTS-ECFP reporter construct 4DepositorInsertsgRNA4_1xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2 _1xCTS-ECFP-pA
Plasmid#200238PurposeMammalian transfections; 1xCTS-ECFP reporter construct 2DepositorInsertsgRNA2_1xCTS
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Daxx KO sgRNA
Plasmid#186939PurposeDaxx KO in mouse ES cellsDepositorInsertDaxx KO sgRNA (Daxx Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorInsertPole4 KO sgRNA (Pole4 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorInsertPole3 KO sgRNA (Pole3 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorInsertH2BC11 sgRNA spacer (H2BC11 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorInsertMYH10 sgRNA spacer (MYH10 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-lacO
Plasmid#181909PurposeSingle guide RNA with 2XMS2 loops targeting bacterial lac operatorDepositorInsertsgRNA-2XMS2-lacO
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e2 sgRNA / hSpCas9
Plasmid#172831PurposeMammalian expression of a sgRNA targeting the exon 2 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Camk2a sgRNA / hSpCas9
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i5 sgRNA / hSpCas9
Plasmid#172829PurposeMammalian expression of a sgRNA targeting the intron 1 position 5 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i3 sgRNA / hSpCas9
Plasmid#172827PurposeMammalian expression of a sgRNA targeting the intron 1 position 3 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i2 sgRNA / hSpCas9
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA5
Plasmid#136460PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PGC1a1 sgRNA
Plasmid#165425PurposeExpression of gRNA against human PGC-1a variant 1DepositorInsertgRNA against PGC-1a variant 1 (PPARGC1A Human, Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_FANCF-mcherry
Plasmid#159786PurposeS. pyogenes sgRNA collocated with pegRNA targeting human FANCF geneDepositorInsertspacer of sgRNA targeting FANCF gene (FANCF Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorInsertXYLT2 sgRNA (XYLT2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Myosin7B-sgRNA
Plasmid#154861PurposeLentiviral expression of Cas9 and sgRNA targeting Myosin7BDepositorInsertMYO7B sgRNA (MYO7B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 S3070F
Plasmid#139325PurposePlasmid expressing a sgRNA to introduce BRCA2 S3070F using base editingDepositorInsertsgRNA to insert BRCA2 S3070F using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 S1363L
Plasmid#139329PurposePlasmid expressing a sgRNA to introduce BRCA1 S1363L using base editingDepositorInsertsgRNA to insert BRCA1 S1363L using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E1754K
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only