We narrowed to 13,716 results for: cas9 genes
-
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-dCas9
Plasmid#220193Purposemini-Tn7 dCas9 expression vectorDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRTagsExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterpromoterlessAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDS_Cas9-NLS
Plasmid#136121PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPRDepositorInsertCDS_AtcoCas9-NLS
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12_Cas9-NLS
Plasmid#136122PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPR. CDS12 for N-term fusion with a CTAGDepositorInsertCDS12_AtcoCas9-NLS(noStop)
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNArodA
Plasmid#149658Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0526Available sinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PflaBS-sgRNAflaB
Plasmid#149643Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PflaBSAvailable sinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0826L-sgRNAflaB
Plasmid#149648Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0826LAvailable sinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNArodA
Plasmid#149655Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PresTS-sgRNAflaB
Plasmid#149644Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PresTSAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PresTL-sgRNAflaB
Plasmid#149645Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PresTLAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0026-sgRNAflaB
Plasmid#149646Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0026Available sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0826S-sgRNAflaB
Plasmid#149647Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0826SAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only