We narrowed to 14,123 results for: cas9 genes
-
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JME5000
Plasmid#129661PurposeEYK1ex_CrisprCas9-yl_RFP: CAS9 vector with EYK1ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRR2
Plasmid#166097PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMK
Plasmid#62818PurposeBacterial constitutive S. pyogenes Cas9 expression plasmidDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pITI1
Plasmid#166094PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-Sa-TdTom. Reporter
Plasmid#99652PurposeRed fluorescent reporter that can be activated by dSa Cas9 activator indicating activityDepositorInsertRFP
ExpressionMammalianMutationdead Cas9Available SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMG005_mNeonGreen_P2A
Plasmid#237215PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmNeonGreen-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMG008_mCherry_P2A
Plasmid#237216PurposeFluorescent reporter codon optimized for Dictyostelid speciesDepositorInsertmCherry-P2A
UseCloningTags3xFLAG-tag, HA-tag, SV40-NLS, and nuleoplasmin NL…Available SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP003
Plasmid#101164PurposeE. coli/S. cerevisiae amdS shuttle vector allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
Tags3x FLAGExpressionMammalianPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only