We narrowed to 4,534 results for: ARA-2
-
-
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96)
Plasmid#50914PurposeExpresses human NKCC1 with truncation of N-terminus and mutations at P676C I730C. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C N-term deletion of aa13-222 in hNKCC1…PromoterCMVAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V A735C (NT549)
Plasmid#50910PurposeExpresses human NKCC1 C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C C723S C724V A735C (NT847)
Plasmid#50865PurposeExpresses human NKCC1 A675C C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationA675C C723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V V729C (NT543)
Plasmid#50907PurposeExpresses human NKCC1 C723S C724V V729C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V V729C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V W733C (NT547)
Plasmid#50909PurposeExpresses human NKCC1 C723S C724V W733C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V W733C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V F728C (NT542)
Plasmid#50906PurposeExpresses human NKCC1 C723S C724V F728C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V F728C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V M727C (NT540)
Plasmid#50905PurposeExpresses human NKCC1 C723S C724V M727C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V M727C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD
Plasmid#169818PurposeExpresses C-terminal flag-tagged CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCCC -> AGTC silent mutations at nt527-530 eli…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-1:PXN-EGFP
Plasmid#87420PurposeHomology arms and linker-EGFP sequence for C-terminus tagging of human PXNDepositorInsertPXN Homology Arms with linker-EGFP (PXN Human)
UseCRISPR; Donor templateTagslinker-EGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-23:TJP1-mEGFP
Plasmid#87429PurposeHomology arms and linker-mEGFP sequence for N-terminus tagging of human TJP1DepositorInsertTJP1 Homology Arms with mEGFP-linker (TJP1 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMarch 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXS-IRES-BLAST flag-CAD S1406A
Plasmid#169820PurposeExpresses C-terminal flag-tagged CAD with mutation of reported PKA phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1406A; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-24:MYH10-mEGFP
Plasmid#87428PurposeHomology arms and linker-mEGFP sequence for N-terminus tagging of human MYH10DepositorInsertMYH10 Homology Arms with mEGFP-linker (MYH10 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 2, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pScalps_Puro_mTet2 catalytic domain HxD
Plasmid#79611PurposeExpression of catalytically inactive mouse Tet2DepositorInsertTet2 (Tet2 Mouse)
UseLentiviralTagsMycMutationMutant Tet2 with H1302Y, D1304A substitutions in …Available SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1859A
Plasmid#169821PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1859A; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-D387A
Plasmid#59778PurposeExpresses optoFGFR1 with mutation in PHR to suppress homointeraction, thus cannot be activated by lightDepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4 h-Stx3 resistant to shRNA #304-2xMyc/His
Plasmid#99746PurposeExpresses human Stx3 with a C-term myc-myc-his that is resistant to shRNA #304 from Sigma Aldrich.DepositorInsertStx3 (STX3 Human)
Tagsmyc-myc-hisExpressionMammalianMutationMade six (6) silent mutations to confer resistanc…PromoterCMV/TOAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pW210-pPB-GA-inducible-CRISPRa-sa_dCas9-VPR-hygR
Plasmid#170808PurposePiggyBac vector to express GA-inducible VPR-Sa_dCas9 with hygromycin resistanceDepositorInsertsExpressionMammalianMutationSynonymous mutation in PYL1 to remove XhoI site (…Available SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only