We narrowed to 19,151 results for: Tat
-
Plasmid#186803PurposeCodon-optimized bacterial expression plasmid. Expresses Twin-Strep(R)-Tev-GSGS-Ubiquitin.DepositorInsertTwin-Strep(R)-Tev-GSGS-Ubiquitin
TagsGS-Strep (WSHPQFER)-GGGSGGGSGGSSA-Strep (WSHPQFER…ExpressionBacterialMutationStrep tag Lysine's mutated to ArginineAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET
Plasmid#193364Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-ACTB-C200-GFPfr1
Plasmid#169798PurposeTHe donor vector for the ACTB gene locus.DepositorInsertDonor sequence to ACTB gene for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted before the st…Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-RaichuEV-Rac1(Y40C)
Plasmid#164903PurposeExpresses a Rac1 FRET sensor RaichuEV-Rac1 which contains a dominant negative mutation Y40C in the Rac1 domain. More useful than T17N mutation due to less harmful to endogenous signaling.DepositorInsertRaichuEV-Rac1 (RAC1 Human)
ExpressionMammalianMutationY40C mutation in the Rac1 domain whcih make the s…Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-p37-Strep-HA
Plasmid#113485PurposeExpression of human p37 with C-terminal strep-HA tagDepositorInsertp37 (UBXN2B Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NL-BCL2L1
Plasmid#113458PurposeNanoLuc-BCL2L1 expression vector (positive control together with pcDNA3.1 PA-mCit-BAD)DepositorInsertBCL2 like 1 (BCL2L1 Human)
UseLuciferaseTagscmyc-NanoLucExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [Chronos-tdTomato]
Plasmid#105834PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_K95M
Plasmid#108106PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & kinase-dead mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001148577)
Plasmid#75638Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ARAF
Plasmid#116713PurposeLentiviral expression of ARAFDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA10.53-Clover
Plasmid#214450PurposeBxbI landing-pad mClover-IRES-puro donor. Use with BxbI expressing plasmid to swap payload into 4.721 landing-pad. Generates constitutively expressing cell line.DepositorInsertmClover
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-SIRPB1
Plasmid#116790PurposeLentiviral expression of SIRPB1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK11-G56W
Plasmid#116687PurposeLentiviral expression of STK11 G56WDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-SAKS1-Strep-HA
Plasmid#113487PurposeExpression of human SAKS1 with C-terminal strep-HA tagDepositorInsertSAKS1 (UBXN1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_T221E
Plasmid#108108PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & TE mutation at LKB1 phosphorylation site) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabe HA-∆Raf1(S642A):ER* puro
Plasmid#72572PurposeExpresses hormone-responsive, feedback-resistant Raf allele with an N-terminal HA tag.DepositorInsertRaf1 (RAF1 Human)
UseRetroviralTagsER* and HAExpressionMammalianMutationamino acids 306-648, serine 642 mutated to alanineAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only