We narrowed to 49,047 results for: prot
-
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailabilityAcademic Institutions and Nonprofits only -
pOTTC588 - pAAV c-fos Nuc-iRFP
Plasmid#59132PurposeAn AAV vector that expresses nuclear localized iRFP under control of the c-fos promoter.DepositorInsertNuclear-localized Infrared Fluorescent Protein
UseAAVTags3xNLSExpressionMammalianPromotermFosAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK3 K261R
Plasmid#80875Purposemammalian expression of ALK3 K261RDepositorInsertALK3 (BMPR1A Human)
TagsHAExpressionMammalianMutationK261R (Kinase inactive)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-GFP11-Clathrin light chain
Plasmid#70217PurposeExpresses GFP11-clathrin light chain in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p65
Plasmid#111190Purposefluorescent fusion proteinDepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SARS2-S-D614 (C-flag)
Plasmid#156420PurposeMammalian expression of SARS-CoV-2 S protein (D614) with the flag tag at C-terminus. Pseudotypes onto the MLV vector but not efficiently to VSV or lentiviral vectors.DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-BiFC-Venus
Plasmid#105804PurposeConcomitant expression of two proteins in fusion with fragments of Venus protein. Protein interactions studies by bimolecular fluorescence complementation (BiFC), including BiFC-FRET assays.DepositorTypeEmpty backboneUseFlp-in competentTagsVN173 (I152L); VC155ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-sfGFP
Plasmid#141184PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with sfGFPDepositorHas ServiceCloning Grade DNAInsertS surface glycoprotein [ Severe acute respiratory syndrome coronavirus 2 ] (S SARS coronavirus 2)
TagsSignal peptide from influenza HA and Superfolder …ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-8his
Plasmid#145145PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8his tagDepositorInsertSecreted receptor binding domain (RBD; a.a. 333-529) of S protein from SARS-CoV-2 (S SARS coronavirus 2)
Tags8his tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-Fc
Plasmid#141183PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with IgG1-FcDepositorInsertSecreted receptor binding domain (RBD; a.a. 333-529) of S protein from SARS-CoV-2 fused to Fc of IgG1 (S SARS coronavirus 2)
TagsFc region of IgG1 (a.a. Asp-221 to Lys-447) and S…ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-MBP-TEV
Plasmid#105771PurposeExpression of your protein of interest in fusion with MBP at the N-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsMBP-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-KIR2DL1(FL)-FLAG
Plasmid#157625PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-KIR2DL4(FL)-FLAG
Plasmid#157624PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EYFP-p65
Plasmid#111192Purposefluorescent fusion proteinDepositorAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 wt
Plasmid#80882Purposemammalian expression of ALK6 WTDepositorAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ2
Plasmid#197415PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-2 σ2 fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-2 σ2
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationencodes R42G substitution, contains silent substi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-NTRK1(FL)-FLAG
Plasmid#157620PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC589 - pAAV c-fos Nuc-eYFP
Plasmid#59133PurposeAn AAV vector that expresses nuclear localized eYFP under control of the c-fos promoter.DepositorInsertNuclear-localized Enhanced Yellow Fluorescent Protein
UseAAVTags3xNLSExpressionMammalianPromotermFosAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNIC-ZB-SPRTNwt-FL
Plasmid#110217PurposeExpression in E. coli of full-length wild-type SPRTN protein, with His and ZB tags at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only