We narrowed to 30,686 results for: PLE
-
Plasmid#42200DepositorInsertGamma 5 (Gng5 Rat)
TagsVenus(1-155)ExpressionMammalianMutationcodon-optimizedPromoterCMVAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPuroR-MCS-GAL4-MiniWhite
Plasmid#165890PurposePuromycin resistant GAL4 driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
8200 Bicistronic_GFP_ires_hygro
Plasmid#64375PurposeThis a retroviral expression plasmid expressing GFP along with hygro resistance geneDepositorInsertEGFP
UseRetroviralTagsEGFPAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE(K294A) NLS-Flag
Plasmid#82469PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzyme, inactive formDepositorInsertmRNA capping enzyme (Rngtt Mouse)
TagsFlag and MycExpressionMammalianMutationchanged Lysine 294 to AlaninePromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE NLS-Flag
Plasmid#82468PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzymeDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Arp3_pLib
Plasmid#173677PurposeArp3 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPK-351
Plasmid#157921PurposepcDNA-CMV-PIF3MTAD-IRES-PhyBGal4DBDDepositorInsertsPIF3-MTAD
IRES
PhyB(1-621)-SV40NLS-Gal4DBD
UseSynthetic Biology; OptogeneticsTagsHA tag and SV40NLSExpressionMammalianMutationpif3 1-523PromoterCMVAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-myc- mCE(Del 25C)
Plasmid#82472PurposeExpresses myc tag and mRNA capping enzyme without 25 amino acid from C-terminalDepositorAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMflPT-o4
Plasmid#101315PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and pac resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
pac resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflST-o4
Plasmid#101316PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and aadA1 resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
aadA1 resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-ccdB-NLS2xmCH
Plasmid#254406PurposeDestination vector for bifluorescence complementation. The plasmid carries NLS-mCherry expressed from the Medicago BCP1promoter.DepositorInsertNLS 2X mCherry expressed from the BCP1 promoter
ExpressionPlantPromoterMt BCP1Available SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pABDP1
Plasmid#249500PurposeBidirectional chloroplast promoter (BDP1) enabling co-expression for transformation of Chlamydomonas reinhardtii photosynthetically deficient strain CC4388DepositorInsertsmVenus (yellow/green fluorescence)
tdTomato (red fluorescence)
UseChlamydomonas reinhardtii chloroplast genomeTagsNoExpressionBacterialMutationChanged of F46L, F64L, M153T, V163A, S175G and t…PromoterBidirectional chloroplast promoter enabling co-ex…Available SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pABDP2
Plasmid#249501PurposeBidirectional chloroplast promoter (BDP2) enabling co-expression for transformation of Chlamydomonas reinhardtii photosynthetically deficient strain CC4388DepositorInsertsmVenus (yellow/green fluorescence)
tdTomato (red fluorescence)
UseSynthetic Biology; Chlamydomonas reinhardtii chlo…ExpressionBacterialMutationChange of F46L, F64L, M153T, V163A, S175G and td…PromoterBidirectional chloroplast promoter enabling co-ex…Available SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pABDP3
Plasmid#249502PurposeBidirectional chloroplast promoter (BDP3) enabling co-expression for transformation of Chlamydomonas reinhardtii photosynthetically deficient strain CC4388DepositorInsertsmVenus (yellow/green fluorescence)
tdTomato (red fluorescence)
UseChlamydomonas reinhardtii chloroplast genomeTagsNoMutationChanged of F46L, F64L, M153T, V163A, S175G and t…PromoterBidirectional chloroplast promoter enabling co-ex…Available SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTARGEX-VAC
Plasmid#242450PurposeTargets high levels of recombinant protein to vacuole. Empty vector. Clone via SapI restriction site. mCherry dropout cassette will enable Red/White screening in E.coli.DepositorTypeEmpty backboneTagsC-terminal propeptide (CTPP) derived from N. taba…ExpressionPlantPromoterdouble 35SAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO979
Plasmid#235756PurposeProtein expression of ScVPS38, untagged + ScVPS30 FRK to DDD at 430-432, untaggedDepositorExpressionYeastMutationFRK430-432DDDAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO359
Plasmid#235750PurposeProtein expression of FL ScVPS34 and FL ScVPS15-ZZDepositorTags3xTEV-ZZExpressionYeastMutationS2A, aa 3-887 and T134A, I851RPromoterGAL-TDH3Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only