We narrowed to 14,467 results for: cas9 genes
-
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA Ser promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGES201
Plasmid#190197PurposeFor CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pSaGuide
Plasmid#64710PurposeCloning and expression of Staphylococcus aureus guide RNADepositorInsertStaphylococcus aureus guide RNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pGMC00018 (aka pRC0082)
Plasmid#195320PurposeMinimal plasmid backbone with multiple cloning site for HDR donor DNA constructionDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterial and MammalianAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pDIV1049
Plasmid#247970PurposeCRISPR-Cas9 vector containing a 20 nt protospacer sequence to target mCitrine. pyrG markerDepositorInsertCas9-AMA1-mCit-gRNA-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only