We narrowed to 13,683 results for: sequence
-
Plasmid#113115PurposeDonor plasmid for knock-in eGFP fusing to the c-terminal of mouse Gata4 coding sequenceDepositorInsertGata4 donor region including homology arms and eGFP
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT/pT7 LasR
Plasmid#193629PurposeConstitutive T7 RNAP-mediated expression of LasR transcription factor for Las quorum sensing system. LasR sequence is codon optimized for E. coli.DepositorInsertLasR
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6-deltaE3
Plasmid#122559PurposeModified block 6, with deletion in E3DepositorInsertAdenovirus 5 genomic region 27859-30803
UseSynthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS_36x-601_MA1+MA3+MA2
Plasmid#114364Purpose36x Widom 601 nucleosome sequenceDepositorInsert36X601-MA1_3_2
UseUnspecifiedExpressionMammalianAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM710
Plasmid#68893PurposeIPTG-inducible CRISPRi vector targeting nonsense sequence (NS), pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPLP1H-mCf
Plasmid#229984PurposeLIC vector for polycistronic expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPLP2H-mCf
Plasmid#229985PurposeLIC vector for improved polycistronic expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPLP3H-mCf
Plasmid#229987PurposeLIC vector for improved multigene expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMH220
Plasmid#122836PurposedCas9 with GreenGate B-C flanking sequencesDepositorInsertNuclease-dead SpCas9 (dCas9), codon-optimised for Arabidopsis
UseGolden gate compatible cloning vectorMutationContains D10A and H840A mutationsAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1 (P001)
Plasmid#161820PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence.DepositorInsertA1-20B1
UseSynthetic BiologyAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBYK01
Plasmid#138656PurposephiOZJ integrating Streptomyces expression vector lacking RDFDepositorTypeEmpty backboneExpressionBacterialPromoterPermE* variant sequence from pDA1652Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMD5
Plasmid#138652PurposephiBT1 integrating Streptomyces expression vectorDepositorTypeEmpty backboneExpressionBacterialPromoterPermE* variant sequence from pDA1652Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQE30-TEV-pro-conA
Plasmid#159527PurposeExpresses pro-concanavalin A, a lectin from Canavalia ensiformis, in E. coli. Includes N-terminal TEV recognition site. Native N-terminal sequence is reconstituted upon TEV cleavage.DepositorArticleInsertCanavalia ensiformis pro-concanavalin A
TagsSix-Histidine tag and tobacco etch virus (TEV) pr…ExpressionBacterialPromoterT5Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-Flp1)
Plasmid#194770PurposeTo insert T2A-Flp1 into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-Flp1 transgene.DepositorInsertT2A-Flp1
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pet28a-ClbB-NRPS-NHis
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmNFM
Plasmid#83126PurposeMouse neurofilament protein M cDNA mammalian expression constructDepositorAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha1-AtUBQ10:HR1bR181/185A-GFP-T35S
Plasmid#211839PurposePlant transient expression cassette for GFP fused to the mutant HR1b degron sequence under UBQ10 promoter.DepositorInsertHR1b
UseSynthetic BiologyTagsGFPExpressionPlantMutationR181A R185APromoterUBIQUITIN10Available SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMD13
Plasmid#138653PurposephiC31 integrating Streptomyces expression vectorDepositorTypeEmpty backboneExpressionBacterialPromoterPermE* variant sequence from pDA1652Available SinceJune 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-SUMO-TAG35-sfGFP
Plasmid#212120PurposeFluorescence plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-TAG35-sfGFP and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertsSUMO-TAG35-sfGFP
M. alvus Pyl-tRNA
TagsHis6 and SUMO-TAG35ExpressionBacterialMutationE35TAG (within SUMO encoding sequence)PromoteraraC and lppAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE80L TriCatcher-RGDSP
Plasmid#112631PurposeTwo SpyCatchers linked by an elastin-like polypeptide with an RGDSP integrin-binding site and a C-terminal SnoopCatcherDepositorInsertTriCatcher-RGDSP
TagsHis6 and TEV cleavage siteExpressionBacterialMutationcentral RGDSP integrin-binding sequencePromoterT5Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-PICK1-rescue
Plasmid#72573PurposeExpresses myc-PICK1 shRNA resistant cDNADepositorInsertPICK1 (Pick1 Rat)
TagsMycExpressionMammalianMutation5 silent mutations around shRNA recognition seque…PromoterCMVAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pEYFP-N1-HsSmg5_H
Plasmid#146474PurposeMammalian Expression of HsSmg5DepositorInsertHsSmg5 (SMG5 Human)
ExpressionMammalianMutationthree non silent mutation A254G (K85R), T980C (L3…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-J6-dCas9-24XGP41-J9
Plasmid#202006PurposeMoClo level 0 dCas9-24XGP41 coding sequence moduleDepositorInsertdCas9-24XGP41
UseSynthetic Biology; Moclo cloning vectorTagsGS linkersAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH183
Plasmid#122856PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Venus Cam KII alpha mutant T286D
Plasmid#29429DepositorInsertVenus CAM KII Alpha
TagsVenusExpressionMammalianMutationT286D mutation in CamKIIa sequenceAvailable SinceJuly 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
MBP-3C-hNorrin(33-133)-1D4_pAcGP67a
Plasmid#216384PurposeBaculovirus transfer vector to secrete MBP-fused human Norrin (residues 118-218)DepositorInsertNorrin (NDP Human)
UseBaculovirusTagsGP64 signal sequence-MBP-3C and Rho1D4ExpressionInsectPromoterPolyhedrinAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSLZ.D.R
Plasmid#51510PurposeSingle component LSL vector. Contains 2x35S:Zif268:FokI followed by the us:NPTII template. This sequence is between the LIR and SIR.DepositorInsertsZif268:FokI
us:NPTII repair template
UsePlant t-dna plasmidTagsNLSPromoter2x35SAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only