We narrowed to 11,233 results for: SHA
-
-
iSKetSnFR2
Plasmid#140467PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR2, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR2
UseTagsHis Tag, HA Tag and Myc tagExpressionBacterialMutationPromoterT7Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
iSKetSnFR1
Plasmid#140466PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR1, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR1
UseTagsHis Tag, HA Tag and Myc tagExpressionBacterialMutationPromoterT7Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mutNSDHL
Plasmid#136428PurposeExpresses NSDHL harboring all currently known mutations within exons 4 and 6 associated with CHILD syndrome.DepositorInserthuman NSDHL with mutations in exon 4 and exon 6 (NSDHL Synthetic, Human)
UseTagsV5-His tagExpressionMammalianMutationC>T = A105V; G>C = A182P; G>A = R199H; G…PromoterCMVAvailable sinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-S149A
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorInsertG3BP1 (G3BP1 Human)
UseTagsMS2BPExpressionMammalianMutationS149APromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorInsertUPF3B (UPF3B Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorInsertEIF3B 3'UTR (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-AVI-Tfap2B-tev-FLAG-2A-Citrine
Plasmid#127776PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Tfap2B in frame with an Avi tag at the N terminus and FLAG-tag and Citrine at the C-terminusDepositorInserttfap2b (TFAP2B Chicken)
UseUnspecifiedTagsAviExpressionMutationPromoterAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII R175/6E-Cas9n-UGI
Plasmid#119142PurposeBase editor made from APOBEC3H Haplotype II RNA binding mutant RR175/6EEDepositorInsertAPOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
UseCRISPRTagsExpressionMutationA3H Hap II RR175/6EEPromoterCMVAvailable sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHHM.X513-iNicSnFR3b-(V7)
Plasmid#124881PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotine, termed iNicSnFRs thus enabling optical subcellular pharmacokinetics for nicotineDepositorInsertiNicSnFR3b-(V7)
UseTagsHA Tag, His Tag, and NAExpressionBacterialMutationNAPromoterT7Available sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Anti-Sense
Plasmid#124438PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertNK3 homeobox 2 (Nkx3-2 Mouse)
UseIn situ probeTagsExpressionMutationPromoterT7Available sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pProEx-Htb-cytATL2(R323Q)-6Gly-sfGFP
Plasmid#124066PurposeE. coli. exp. and purif. of X. laevis cytATL-R232Q fragment fused to GFP in c-terminus.DepositorInsertcytATL-R232Q-sfGFP
UseTagssfGFPExpressionBacterialMutationR232QPromotertrcAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Nkx3-2_Sense
Plasmid#124437PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertNK3 homeobox 2 (Nkx3-2 Mouse)
UseIn situ probeTagsExpressionMutationPromoterT7Available sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Sense
Plasmid#124441PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertRAB28, member RAS oncogene family (Rab28 Mouse)
UseIn situ probeTagsExpressionMutationPromoterT7Available sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Rab28_Anti-Sense
Plasmid#124442PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertRAB28, member RAS oncogene family (Rab28 Mouse)
UseIn situ probeTagsExpressionMutationPromoterT7Available sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-V111FL114FI766F-HA-TagBFP
Plasmid#120911PurposeExpresses BFP tagged Ptch1-B (V111FL114FI766F)DepositorInsertPtch1 (Ptch1 Mouse)
UseTagsHA and TagBFPExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, Y…PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-V111FL114FW115A-HA-GFP
Plasmid#120908PurposeExpresses Ptch1-B (V111FL114FW115A)DepositorInsertPtch1 (Ptch1 Mouse)
UseTagsGFP and HAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-I766FV111F-HA-GFP
Plasmid#120907PurposeExpresses Ptch1-B (I766FV111F)DepositorInsertPtch1 (Ptch1 Mouse)
UseTagsGFP and HAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-Y233C-HA
Plasmid#120904PurposeExpresses Ptch1-B (Y233C) for function assaysDepositorInsertPtch1 (Ptch1 Mouse)
UseTagsHAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, Y…PromoterCMVAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-L234C-HA
Plasmid#120905PurposeExpresses Ptch1-B (L234C)DepositorInsertPtch1 (Ptch1 Mouse)
UseTagsHAExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, L…PromoterCMVAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[bTub+DsxF].1046A
Plasmid#112694Purposeexpress two gRNA targeting bTub & DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNTB1_PDZ_1
Plasmid#103951PurposeProtein expression and purification of TAX INTERACTION PROTEIN 43 PDZ domainDepositorInsertSNTB1 (SNTB1 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
USH1C_PDZ_2
Plasmid#103937PurposeProtein expression and purification of P73 PDZ2 domainDepositorInsertUSH1C (USH1C Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only
