We narrowed to 9,959 results for: Met
-
Plasmid#82346PurposeExpresses FLAG-tagged SLC30A10-D248A in mammalian cellsDepositorAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
FLAG-SLC30A10-N43H
Plasmid#82344PurposeExpresses FLAG-tagged SLC30A10-N43H in mammalian cellsDepositorAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-NHL only-LIN-41
Plasmid#52723Purposeretroviral expression of human LIN-41 / TRIM71 containing only the NHL repeats and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationNHL-only contains only an initiating methionine a…Available sinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH104
Plasmid#48262PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae TEF1 promoter in yeast.DepositorInsertsTEF1p 5' fragment
URA3 5' fragment
TEF1p 3' fragment
UseRoutine cloning vectorMutationFrom SK1 background. -343 to -1 relative to TEF1 …PromoterTEF1pAvailable sinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-Venus-cpVenus-FLARE-AKAR
Plasmid#123329PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
WT N-His Ana GvpC in pET28a
Plasmid#153294PurposeExpresses N-terminal His-tagged GvpC from Anabaena flos-aquae in E.coliDepositorInsertGas vesicle protein C (N-terminal his-tagged)
TagsHis-tagExpressionBacterialMutationAdded a hexahistidine tag after the methionine at…PromoterT7Available sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp7-Nsp8-HF_GC3opt
Plasmid#157693Purposemammalian expression of C-terminally His8-Flag tagged Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp7-Nsp8-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-Venus-cpVenus-FLARE-CKAR
Plasmid#123343PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-CKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p35S::IRE1a
Plasmid#135232Purposeconstitutive expression of IRE1a from A. thaliana (AT2G17520; upregulates UPR signaling)DepositorAvailable sinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB63 - pL0_fLUC-I (CDS1)
Plasmid#123180PurposeGolden Gate (MoClo; CDS1) compatible luciferase gene from Photinuspyralis with an intron for transient and stable expression in plantsDepositorInsertLuciferase gene from Photinuspyralis with intron from U5 small nuclear ribonucleoprotein component (Arabidopsis thaliana)
UseLuciferase; Part for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1585588
Plasmid#62620PurposeePathBrick pETM6 vector encoding CsF3H, CsDFR, and DuLAR (1:3:3 Ratio)DepositorInsertsflavaone 3B-hydroxylase
dihydroflavonol 4-reductase
leucoanthocyanidin reductase
dihydroflavonol 4-reductase
dihydroflavonol 4-reductase
leucoanthocyanidin reductase
leucoanthocyanidin reductase
UseSynthetic BiologyTagsGBD, PDZ, and SH3ExpressionBacterialPromoterT7Available sinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-hMeCP2-G273X
Plasmid#48093PurposeBacterial expression of Mxe intein/chitin binding domain tagged MeCP2-G273XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
ExpressionBacterialMutationMxe intein/chitin binding domain tagged, expresse…Available sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG CMV14 / BRAF-G469V
Plasmid#131718PurposeMammalian Expression of Flag tagged BRAFDepositorAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p3xFLAG CMV14 / BRAF-D594N
Plasmid#131713PurposeMammalian Expression of Flag tagged BRAFDepositorAvailable sinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-ARNT-d414
Plasmid#203579PurposeExpresses a functionally inactive version of ARNT with 5’ 414 bp deletion [Δ414] in mammalian cells.DepositorInsertARNT (ARNT Human)
UseLentiviralTagsV5ExpressionMammalianMutation5' 414 basepair deletion [Δ414]PromoterCMVAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only