-
Plasmid#223453Purposensf-1 fluorescent neural reporter driving nuclear TagRFP-T expression (refer to NeuroPAL paper for expression)DepositorInsertnsf-1 (nsf-1 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY117
Plasmid#223464Purposeser-2(prom1B) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertser-2(prom1B) (ser-2 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY116
Plasmid#223463Purposesax-3 fluorescent neural reporter driving nuclear CyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInsertsax-3 (sax-3 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY140
Plasmid#223487Purposetrp-4 fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInserttrp-4 (trp-4 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY147
Plasmid#223494Purposeunc-86 fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInsertunc-86 (unc-86 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY115
Plasmid#223462Purposepdfr-1 (3-2K) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertpdfr-1(3-2K) (pdfr-1 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY145
Plasmid#223492Purposeunc-42 fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInsertunc-42 (unc-42 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY141
Plasmid#223488Purposetrp-4(intron 1) fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInserttrp-4(intron 1) (trp-4 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY146
Plasmid#223493Purposeunc-46 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorInsertunc-46 (unc-46 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY119
Plasmid#223466Purposeser-2(promCE) fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorInsertser-2(promCE) (ser-2 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY143
Plasmid#223490Purposeunc-31 fluorescent neural reporter driving nuclear TagRFP-T expression (refer to NeuroPAL paper for expression)DepositorInsertunc-31 (unc-31 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY112
Plasmid#223459Purposeoig-1 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertoig-1 (oig-1 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY113
Plasmid#223460Purposeosm-10 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorInsertosm-10 (osm-10 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY133
Plasmid#223480Purposesrz-45 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertsrz-45 (srz-45 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY130
Plasmid#223477Purposesrx-113 fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertsrx-113 (srx-113 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY131
Plasmid#223478Purposesrx-105 fluorescent neural reporter driving nuclear CyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInsertsrx-105 (srx-105 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY137
Plasmid#223484Purposetax-2 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorInserttax-2 (tax-2 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY138
Plasmid#223485Purposetol-1(3k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInserttol-1(3k) (tol-1 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEY144
Plasmid#223491Purposeunc-39(3k) fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInsertunc-39 (3k) (unc-39 Nematode)
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSX2739
Plasmid#200765PurposeExpresses mKate2-tag fused CDC-42 with 8xMS2(V1) stem loops in C. elegans, and the tissue-specific promoter col-19 is used.DepositorInsert8xMS2
UseTagsmKate2ExpressionWormMutationPromotercol-19Available sinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pHMTc-FBF-2 (121-632)
Plasmid#218664PurposeExpression of MBP:6xHIS:FBF-2(121-632)DepositorInsertfbf-2 (fbf-2 Nematode)
UseTagsMBP-6xHISExpressionBacterialMutationamino acids 121-632 onlyPromoterAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorUseTagsExpressionWormMutationD387A, E490GPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV12 [psng-1::SNG-1::CRY2olig(535)]
Plasmid#197596PurposePan-neuronal expression of SNG-1::CRY2olig(535) in neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
RT-5
Plasmid#220442PurposeConstruct used to generate the PUF3/PUP2/3HA tagging strains. (aka pBSII/PUF3 5’ flank/PUP2-DADA/3HA/URA3/PUF3 3’ flank)DepositorInsertPUF3 (puf-3 Nematode)
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK2097
Plasmid#218665PurposeExpression of MBP:6xHIS:FBF-2(Y479A, 121-632)DepositorInsertfbf-2 (fbf-2 Nematode)
UseTagsMBP-6xHISExpressionBacterialMutationamino acids 121-632 only, with Y479A mutationPromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4293
Plasmid#200161PurposePtwk-40s GCaMP6s::mNeptune unc-54 3' UTR C.elegans AVA,AVB and other neurons expression of GCaMP6 mNeptuneDepositorInsertGCaMP6
UseTagsmNeptuneExpressionWormMutationPromoterPtwk-40Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4316
Plasmid#200171PurposePflp-18 LoxP EBFP (stop) LoxP twk-40(gf) GFP unc-54 3' UTR C.elegans AVA and other neurons expression of twk-40(gf) GFPDepositorInserttwk-40 (twk-40 Nematode)
UseTagsGFPExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4562
Plasmid#200780PurposePflp-18 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of GtACR2 RFPDepositorInsertGtAR2
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4609
Plasmid#200781PurposePpdf-1 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVB and other neurons expression of GtACR2 RFPDepositorInsertGtACR2
UseTagsmCherryExpressionWormMutationPromoterPpdf-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4677
Plasmid#200782PurposePnpr-4 ins-22::GFP unc-54 3' UTR C.elegans AVA and other neurons expression of ins-22 GFPDepositorInsertins-22 (ins-22 Nematode)
UseTagsGFPExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4693
Plasmid#200784PurposePtwk-40s EGFP unc-54 3' UTR C.elegans AVA and other neurons expression of EGFPDepositorInsertno
UseTagsGFPExpressionWormMutationPromoterPtwk-40sAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4783
Plasmid#200785PurposePnpr-4 snb-1::pHluorin unc-54 3' UTR C.elegans AVA and other neurons expression of snb pHluorinDepositorInsertsnb-1 (snb-1 Nematode)
UseTagspHiuorinExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH3830
Plasmid#200038PurposePrig-3 zif-1 SL2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of zif RFPDepositorInsertZIF (zif-1 Nematode)
UseTagsmCherryExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorInsertzif-1 (zif-1 Nematode)
UseTagsEBFPExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2829
Plasmid#199693PurposePcex-1 tomm-20::miniSOG UrSL mCherry unc-54 3' UTR C.elegans RIM neuron expression of miniSOG RFPDepositorInsertminiSOG
UseTagsRFPExpressionWormMutationPromoterPcex-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxTagsExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341PromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT348
Plasmid#204515PurposeBacterial expression of CEC-5 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of cec-5 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00003755, nlp-17Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011644, T09B9.3Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only