We narrowed to 11,379 results for: ENA
-
Plasmid#12805PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf117
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
E1010m (RFP)_CD
Plasmid#66033PurposeMoClo Basic Part: CDS - Fluorescent protein. Red. Modified from Bba_E1010 to fix illegal sites. [C:E1010m:D]DepositorInsertFluorescent reporter - RFP
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i1
Plasmid#59612PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2121
Plasmid#91065PurposeModule B, Promoter: GmUbi, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterGmUbiAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516
Plasmid#91084PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-RIPK3 2KR(55,363)
Plasmid#78811PurposeTo overexpress RIPK3 2KR(55,363) in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-YFP-NLS
Plasmid#127365PurposeBinary vector for expressing nuclear BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf166
Plasmid#12854PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf166
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD6A (OTU, aa 128-288)
Plasmid#61417PurposeExpresses human OTUD6A (OTU domain) in E. coli.DepositorInsertOTUD6A (OTUD6A Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-127.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i2
Plasmid#59613PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pK-SAN1-Flag
Plasmid#117163PurposeExpresses Flag-tagged SAN1 nuclease in mammalian cells.DepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJMP1341
Plasmid#119272Purposecontrol sgRNA in cells lacking rfpDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -