We narrowed to 33,417 results for: IND
-
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Klf4 TALE-GCN4
Plasmid#120546PurposeExpress 3xNLS-Klf4 TALE-GCN4 engineered to bind a site in the human KLF4 geneDepositorAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSlick-Neo-KANK1
Plasmid#121983PurposeTetracycline-inducible expression of untagged full-length KANK1DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.N
Plasmid#127851Purposenon-standard AAV2 rep-AAV-PHP.N cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.N VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianPromoterCMV, SP6Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertVillin-mTQ2-P2A-FlpO-ERT2
TagsmTQ2, linked to FlpO through an P2A ribosomal ski…ExpressionMammalianPromoterVillinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPE-Plus
Plasmid#214062Purposeinducible PE-Plus system for controllable prime editing; this plasmid is used to insert PE-Plus prime editor (PEmax-P2A-hP53DD-IRES-MLH1dn) in one allele of AAVS1 locusDepositorInsertPE-Plus
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NES
Plasmid#136467PurposeMammalian expression of cytoplasm targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsNuclear export signal from the HIV Rev proteinExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsSMAC/DIABLOExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQY527A-IRES-mCherry
Plasmid#166951PurposeLentiviral plasmid expressing GFP-tagged SFPQ Y527A protein with IRES-mCherry from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsGFP and mCherryMutationSFPQ-Y527APromotereF1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PDi-CRISPRn
Plasmid#73500PurposeDox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locusDepositorInsertsCas9
rtTA
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCAG and TREAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only