We narrowed to 23,118 results for: Sis
-
Plasmid#107500PurposeExpresses MXRA7, puromycin resistantDepositorInsertMXRA7 (codon optimized) (MXRA7 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) VOPP1
Plasmid#107507Purposeexpressing VOPP1, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_LUP1
Plasmid#103857PurposeHeterologous, cobalt-inducible expression of SQE1 and LUP1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertlupeol synthase 1 (LUP1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-8
Plasmid#122233PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-4
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) RALB
Plasmid#107506PurposeExpressing RALB, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK3/BAK1 BAKNcFus_pECIA14
Plasmid#114775PurposePrey vector SERK3/BAK1 BAKNcFus_pECIA14 should be used with bait vector SERK3/BAK1 BAKNcFus_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana IMPORTIN ALPHA 3 / MOS6
Plasmid#175820PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 3 / MOS6, lacks start ATG and includes stop codon for N-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 3 (MOS6 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnonePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) TSPAN9
Plasmid#107502PurposeExpresses TSPAN9, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C
Plasmid#89717PurposeLentiviral gene expression vector for doxycycline inducible MEF2C expressionDepositorAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) IGF1R
Plasmid#107499PurposeExpresses IGF1R, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C
Plasmid#89715PurposeRetroviral gene expression vector for MEF2C expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) EPB41L1
Plasmid#107508PurposeExpressing EPB41L1, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C S222A
Plasmid#89718PurposeLentiviral gene expression vector for doxycycline inducible MEF2C-S222A expressionDepositorInsertMEF2C (MEF2C Human)
UseLentiviralExpressionMammalianMutationChanged serine 222 to alanineAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) FAM149A
Plasmid#107510PurposeExpressing FAM149a, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) CRIP2
Plasmid#107509PurposeExpressing CRIP2, puromycin resistantDepositorInsertCRIP2 (codon optimized) (CRIP2 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSAR-MT
Plasmid#16485DepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJK210
Plasmid#73325PurposeProduces Janthinobacterium lividum violacein biosynthesis protein VioDDepositorInsertviolacein biosynthesis protein VioD
ExpressionBacterialPromoterT7Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK265
Plasmid#73598PurposeProduces Janthinobacterium lividum violacein biosynthesis protein VioC with a N-terminal His6 tagDepositorInsertviolacein biosynthesis protein VioC
TagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK261
Plasmid#73323PurposeProduces Janthinobacterium lividum violacein biosynthesis protein VioA with a N-terminal His6 tagDepositorInsertviolacein biosynthesis protein VioA
TagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-T7-PAB1-NLuc
Plasmid#219984PurposePAB1-5'UTR-NLuc mRNA synthesisDepositorInsertPAB1-5'UTR-NLuc (PAB1 Budding Yeast)
ExpressionBacterialAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK196
Plasmid#73322PurposeProduces Janthinobacterium lividum violacein biosynthesis protein VioD with a N-terminal His6 tagDepositorInsertviolacein biosynthesis protein VioD
TagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only