We narrowed to 8,818 results for: chloramphenicol
-
Plasmid#46858PurposeFX sequencing vector for subcloning, chloramphenicol markerDepositorTypeEmpty backboneUseSequencing vectorPromoternoneAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiPromoter2x35SAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK501
Plasmid#48107PurposelacZ promoter-probe plasmid with pVS1 origin of replication and chloramphenicol resistanceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-B/c
Plasmid#199559PurposeGATEWAY-compatible entry vectorDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseGateway CloningAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2SCb
Plasmid#59385PurposeTemplate plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.DepositorInsertTT-ISceI-cat2
UseTemplateMutationThe 3’-end of the chloramphenicol resistance gene…Available SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_H2_beta_CM
Plasmid#184870PurposepSwap plasmid part with H2_beta homology arms and chloramphenicol cassetteDepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceMarch 2, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSL144
Plasmid#252945PurposeLabel Lactiplantibacillus plantarum with sfGFP (chloramphenicol-resistant)DepositorArticleInsertsfGFP
ExpressionBacterialPromoterP23Available SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTKDP-cat
Plasmid#71321PurposeDonor plasmid - chloramphenicol resistant donor cassetteDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceDec. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
p15A-OptoCre-cat-P-R
Plasmid#189853PurposeCre-inducible activation of cat for chloramphenicol resistance.DepositorInsertP-loxP-TT-loxP-R-cat
UseCre/Lox and Synthetic BiologyExpressionBacterialPromoterP (T7 phage gene 10)Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFLxR1
Plasmid#149496PurposeBroad-Host range expression vector, RSF1010 origin, LuxR activator, PLuxB promoter, mRFP, Chloramphenicol Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPLuxBAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
p15A-OptoCre-cat-T172A-P-R
Plasmid#189854PurposeCre-inducible activation of cat-T172A for chloramphenicol resistance.DepositorInsertP-loxP-TT-loxP-R-catT172A
UseCre/Lox and Synthetic BiologyExpressionBacterialPromoterP (T7 phage gene 10)Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCm C-term MBP NikJC199U
Plasmid#174365PurposeExpression plasmid with a TEV removable C-term 8xHis tagged MBP tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, MBP, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-A18G-B/c
Plasmid#246715PurposeEntry plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites (MIR390a Mustard Weed)
UseGateway CloningAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-A18G-B/c
Plasmid#246716PurposeCloning amiRNA sequences in AtMIR390a-A18G precursors for in planta expressionDepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation & chloramphenicol-ccdB cassette flanked by two BsaI sites (MIR390a Mustard Weed)
UseRNAiExpressionPlantAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDCAF3-IS5
Plasmid#65220PurposeExpresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.DepositorInsertsndmA
ndmB
ndmC
ndmD
gst9
chlR
UseSynthetic BiologyExpressionBacterialMutationChanged start codon from gtg to atg and Changed s…PromoterBBa_J23100Available SinceJan. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSL143
Plasmid#252946PurposeChloramphenicol-resistant empty vector for Lactiplantibacillus plantarumDepositorArticleTypeEmpty backboneExpressionBacterialAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSL168
Plasmid#252942PurposeChloramphenicol-resistant empty vector for Lactococcus lactisDepositorArticleTypeEmpty backboneExpressionBacterialAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTuLys2CMR2
Plasmid#53544PurposeInhibition module. Constructed from the parent plasmids pLuxRI, pLuxmCherry, pET15bLCFPT7, and pLysS. The plasmid can express T7 lysozyme by inducing AHL and LuxR. Chloramphenicol resistanceDepositorInsertpLux
UseUnspecifiedAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
DVC_p15A_AF
Plasmid#217588PurposeDestination vector with chloramphenicol resistance and p15A origin of replication. Carries A-F CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only