We narrowed to 17,159 results for: REV
-
Plasmid#163459Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPR-v1-sgGLS_6
Plasmid#163460Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-N--Grb2-2
Plasmid#112837Purposetransient/stable overexpressionDepositorAvailable SinceAug. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
NPRL2_pLX307
Plasmid#98364PurposeLentiviral expression of NPRL2DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs2-MEK1
Plasmid#86141PurposeRetroviral vector expressing MEK1-IRES-Bsd-p2A-RFPDepositorAvailable SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Plxna4-Fc-His
Plasmid#72125PurposeExpresses the extracellular region of the PlexinA4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD1 (OTU, aa 287-437)
Plasmid#61407PurposeExpresses human OTUD1 (OTU domain) in E. coli.DepositorInsertOTUD1 (OTUD1 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-286 and aa 438-481.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-PTK2-C-10
Plasmid#55441PurposeLocalization: FAK/Focal Adhesions, Excitation: 433, Emission: 475DepositorAvailable SinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKT0210
Plasmid#8724DepositorInsertyECFP A206R
TagsCodon optimized linkerExpressionYeastMutationyEGFP with F64L, S65T, Y66W, N146I, M153T, V163A,…Available SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:Venus-Tub1+3'UTR::LEU2
Plasmid#50644DepositorInsertVenus-Tub1
UseYeast expressionTagsVenusPromoterHIS3pAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mEos2-Tub1+3'UTR::TRP1
Plasmid#50652DepositorInsertmEos2-Tub1
UseYeast expressionTagsmEos2PromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mTurquoise2-Tub1+3'UTR::TRP1
Plasmid#50647DepositorInsertmTurquoise2-Tub1
UseYeast expressionTagsmTurquoise2PromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mEos2-Tub1+3'UTR::HPH
Plasmid#50634DepositorInsertmEos2-Tub1
UseYeast expressionTagsmEos2PromoterHIS3pAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
ClhN-pADH3-4V5-APEX2-URA
Plasmid#207063PurposeBackbone plasmid containing ADH3 promoter and 4V5-APEX2 tag.DepositorInsert4xV5-APEX2
ExpressionYeastPromoterpADH3Available SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT2
Plasmid#98306PurposeOverexpressing yeast farnesyl pyrophosphate synthase Erg20p mutant N127W and Actinidia chinensis nerolidol/linalool synhtase AcNES1 under the control of TEF1/TEF2 promoterDepositorInsertPTEF2>ScERG20N127W>TRPL3>PTEF1>AcNES1>TRPL41B
ExpressionYeastMutationERG20 N127WAvailable SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS415-SOH1
Plasmid#8622DepositorAvailable SinceNov. 15, 2005AvailabilityAcademic Institutions and Nonprofits only