We narrowed to 11,805 results for: NSI
-
Plasmid#226309PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-3
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-coSnaA-TEV-His_His-TEV-SnaC
Plasmid#225059Purposerecombinant expression of SnaA in E. coliDepositorInsertSnaA
ExpressionBacterialPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRSET-Cm-CspB
Plasmid#215400PurposeCm NCPPB382 cspB codon-optimized for E. coli recombinant protein expression (6xHis-CspB)DepositorInsertcspB
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSET-Cm-CspA2
Plasmid#215399PurposeCm NCPPB382 cspA2 codon-optimized for E. coli recombinant protein expression (6xHis-CspA2)DepositorInsertcspA2
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-11_humanized-mutant
Plasmid#214316PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_R269D
Plasmid#214310PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_K356D
Plasmid#214309PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sars Cov 2 MPRO R188S mutantSARS-CoV-2 Mpro protease (R188S mutant - clinical mutant); aliases: 3CLpro, 3C-like
Plasmid#204785PurposeBacterial expression of Sars Cov 2 MPRO R188S mutantDepositorAvailable SinceJan. 23, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
ZIKV NS2B-NS3 protease (H115A- catalytically inactive); aliases: Zika Virus NS2B-NS3 fusion protein expressed with N-terminal Tw
Plasmid#204791PurposeBacterial expression of a fusion of Zika NS2B-NS3 proteinsDepositorInsertZika NS2B-NS3 fusion
Tags6 HisExpressionBacterialAvailable SinceJan. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
WNV NS2B-NS3 protease (based on PDB 2IJO, catalytically active); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204799PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceDec. 11, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SARS-CoV-2 Mpro protease (R188K mutant - clinical mutant); aliases: 3CLpro, 3C-like
Plasmid#204770PurposeBacterial expression of Sars Cov 2 MPRO R188K mutantDepositorAvailable SinceNov. 30, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
TagsmCerulean3ExpressionMammalianPromoterCMV (+enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 AMSHLP 16-218
Plasmid#180609PurposeBacterial expression for AMSHLP MIT domain residues 16-218. Internal ID: WISP20-83DepositorInsertAMSHLP residues 16-218
TagsHIS-SUMOExpressionBacterialMutationResidues 16-218PromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOBD2
Plasmid#196826PurposeYeast two-hybrid ; Gal4 DNA binding domainDepositorTypeEmpty backboneTagsGal4 DNA binding domainExpressionYeastPromoterADHAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-Cre-StLS1-9
Plasmid#197722PurposePhytobrick (MoClo) Level 0 PartDepositorInsertCre recombinase with St-LS1 intron (maize optimized)
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only