We narrowed to 1,509 results for: U6 promoter
-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 neo
Plasmid#13425Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses neomycin for selection.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiExpressionMammalianPromoterU6 promoterAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-yA
Plasmid#191015PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.DepositorInsertyA
UseCRISPRPromoterAspergillus flavus U6Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-gRNA2.1
Plasmid#170512PurposegRNA cloning vector containing a U6:3 promoter and a gRNA2.1 scaffold.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Circular guide cloning vector
Plasmid#180184PurposeCloning vector for expressing circular RNA from a U6 promoterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterU6Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-STOP-shA1
Plasmid#14422DepositorInsertmodified U6 promoter (U6lox), U6 STOP cassette, shA1 gene
UseCre/Lox and RNAiExpressionMammalianAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xMS2_SL]
Plasmid#68426PurposeTransient expression in mammalian cells of an "INT" construct_bearing three MS2 Stem-loops, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing three MS2 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[BoBS]
Plasmid#68431PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "Bunch of Baby Spinach" (or "BoBS") construct, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the "Bunch of Baby Spinach" (or "BoBS") construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAdSh.U6.gRNAGFP
Plasmid#58255PurposeU6 promoter-driven single guide RNA complementary to eGFPDepositorInsertU6.gRNAGFP cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[Spinach2]
Plasmid#68430PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "Spinach2" aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the "Spinach2" aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_TOP1
Plasmid#68423PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-nlsBFP
Plasmid#169029PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-mTagBFP-NLS marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRUSH
Plasmid#54479PurposeMouse genomic ROSA26 targeting vector, expresses EGFP, U6promoter to drive short RNAs, pgkneo, cassette flanked by loxP sitesDepositorTypeEmpty backboneUseCre/Lox, Mouse Targeting, and RNAiTagsSA-EGFP-polyA, U6 promoter, loxP, and pgk-neoExpressionMammalianPromoterU6Available SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPN144
Plasmid#91673PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN145
Plasmid#91674PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only