We narrowed to 7,629 results for: /1000
-
Plasmid#66258PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only
-
His-FLAG-Tev_ACTA1 (alpha-actin)
Plasmid#188452PurposeExpress in mammalian cells human alpha-actin (ACTA1) with N-terminal 6xHis tag, FLAG tag, and TEV protease site.DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-Jun4A-Myc
Plasmid#47444Purposemammalian expression of mutant c-Jun (four N-terminal residues phosphorylated by JNK are mutated into Alanines)DepositorInsertJun 4A mutant (Jun Mouse)
TagsFlag and mycExpressionMammalianMutationfour N-terminal residues phosphorylated by JNK, s…PromoterCMVAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hAID-BE3
Plasmid#113417PurposeExpresses hAID-BE3 in mammalian cellsDepositorInserthAID-BE3 (AICDA Human, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1b-3X FLAG
Plasmid#218536Purposehuman FLVCR1b with C-terminal 3X_FLAG cDNADepositorInsertFLVCR1 (FLVCR1 Human)
UseRetroviralTagsFLAG (3X)ExpressionMammalianMutationAlternative isoformAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1/FLVCR1a-3X FLAG
Plasmid#218534Purposehuman FLVCR1/FLVCR1a with C-terminal 3x-FLAG cDNADepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1/FLVCR1a
Plasmid#218533Purposehuman FLVCR1/FLVCR1a cDNADepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xA
Plasmid#92007PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTetON-BMP2/7
Plasmid#137913PurposeInducible mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, divergent)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAND1-T2A-dTom-PGK-Neo
Plasmid#209838PurposeTomato reporter plasmid targeting the human HAND1 geneDepositorInsertHAND1-T2A-dTomato-PGK-Neo-HAND1 (HAND1 Human)
UseHuman targetingAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-DuET
Plasmid#213233PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-Bcl2-Cb5
Plasmid#18004DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsFlagExpressionMammalianMutationC terminal of Bcl-2 replaced with Cytochrome b5. …PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xE
Plasmid#92008PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)1x
Plasmid#112055PurposeACTB mRNA tagged with 1 copy of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation1 copy of Riboglow tag (variant A) after stop cod…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-EGFPC-uL10-(Neo)R
Plasmid#158069PurposeeGFP and uL10 ribosomal protein under the TRE3G promoter, Neo resistanceDepositorAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-Tango
Plasmid#66274PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only