We narrowed to 13,238 results for: BASE
-
Plasmid#178823PurposeExpresses an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseLentiviralTagsCitrineExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp10
Plasmid#156479PurposeBacterial expression of Sars-CoV2 Nsp10 protein with His-tag and GST-tagDepositorInsertNsp10 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin1 KI #2
Plasmid#139658PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: D23)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AP4mS_PPVs_P3_cLuc
Plasmid#119300PurposeExpresses C-terminus of split luciferase fused to P3 coil, PPVs cleavable linker and autoinhibitory coil AP4/for split protease-cleavable orthogonal Coiled-coil (SPOC) logicDepositorInsertsplit cLuc fused to P3coil-PPV cleavage site and autoinhibitory coil AP4mS
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NL-BCL2L1
Plasmid#113458PurposeNanoLuc-BCL2L1 expression vector (positive control together with pcDNA3.1 PA-mCit-BAD)DepositorInsertBCL2 like 1 (BCL2L1 Human)
UseLuciferaseTagscmyc-NanoLucExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-PGK-Puro
Plasmid#110860PurposeLentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Blast
Plasmid#227270PurposeEmpty AAVS1 targeting donor for the insertion of Blast and a medium strength PGK promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual-IN-SMN1
Plasmid#215721Purposedual-color reporter express eGFP constitutively ; tdTomato expression is contingent on the inclusion of the frame-shifting cassette exon 7; expresses SMN1DepositorInsertSMN1 EXON 7 (SMN1 Human)
ExpressionMammalianAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mScarlet-Puro-H2BC11
Plasmid#207761PurposeDonor template for mScarlet-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a mScarlet-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1_nV5-AMOT (p130)
Plasmid#172997Purposeconstitutive expression of V5-tagged AMOT (p130)DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MMLV-gag-hMLH1dn
Plasmid#195513PurposeMMLV-Gag fused to hMLH1dn with TSTLLMENSS cleavage site between Gag-NES and hMLH1dn. For production of virus like particles with base-editor RNP cargo.DepositorInserthMLH1dn (MLH1 Human)
UseVirus like particleTagsFLAG, NES, and Protease cleavate siteExpressionMammalianMutationHuman MLH1 del754-756PromoterCMVAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTPH418b
Plasmid#185725PurposeDirected evolution of Cas9 adenine base editors with altered PAM compatibilityDepositorInsertgIII(N)-NpuN-NpuC-gIII(C)
UseCRISPRExpressionBacterialAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTPH412
Plasmid#185724PurposeDirected evolution of Cas9 adenine base editors with altered PAM compatibilityDepositorInsertecTadA(8e)-gp41-8N
UseCRISPRExpressionBacterialMutationecTadA(8e) R26GAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p13xQUAS-MCS, α-cry:mCherry
Plasmid#180481PurposeInducible gene expression vector p13xQUAS-MCS, α-cry:mCherryDepositorInsertMultiple cloning site
UseSynthetic BiologyAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Negative Control Binder
Plasmid#179140PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9) and an additionional A70Q mutation greatly reduces affinity for SsrA peptideDepositorInsertSspB
TagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9. Addi…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only