We narrowed to 81,735 results for: TRI
-
Plasmid#205090PurposeExpress GFP-tagged human integrin β5 in mammalian cellsDepositorAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pDGM6
Plasmid#110660PurposeAdeno-Associated Virus (AAV) serotype 6; contains the AAV6 cap genes, AAV2 rep genes, and adenovirus helper genes. Good for in vivo transduction of muscle, lung, liver and other tissues.DepositorInsertAAV6 cap genes, AAV2 rep genes, adenovirus helper genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AY22_pgRNA.R5.1
Plasmid#100294PurposeCCR5-targeting gRNA expression plasmidDepositorInsertgRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6 RNA Pol III promoter human snRNAAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUB1 (full-length, aa 1-271)
Plasmid#61420PurposeExpresses human OTUB1 (full-length) in E. coli.DepositorInsertOTUB1 (Ubiquitin thioesterase OTUB1) (OTUB1 Human)
TagsHis6-GST-3CExpressionBacterialPromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne (OTU, aa 53-446)
Plasmid#61581PurposeExpresses human Cezanne (OTU domain) in E. coli.DepositorInsertCezanne (OTUD7B Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-52 and aa 447-843.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk-GFP
Plasmid#51463PurposeIs a biosensor for PIP3DepositorAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1 MOSPD3
Plasmid#226405PurposeExpression of human MOSPD3 fused to EGFP in mammalian cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-Tetherin
Plasmid#41070DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
CDK1as_T2A_puromycin
Plasmid#118595PurposeOne of three plasmids required to create CDK1as human cells by single transfection (One shot system). CDK1as cDNA and puromycin resistance cassette flanked by Sleeping Beauty transposon.DepositorInsertCDK1
ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1 MOSPD1
Plasmid#226404PurposeExpression of human MOSPD1 fused to EGFP in mammalian cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO mScarlet
Plasmid#131002PurposeDouble floxed mScarlet under the control of Ef1a promoterDepositorHas ServiceAAV1 and AAV5InsertmScarlet
UseAAVPromoterEf1aAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+H1.4
Plasmid#157796PurposeExpression of human linker histone H1.4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-hAtg2A
Plasmid#36456DepositorInsertautophagy-related protein 2 homolog A (ATG2A Human)
TagsEGFPExpressionMammalianMutationchanged Proline 656 to ArgininePromoterCMVAvailable SinceMay 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
CDK1as_T2A_Zeo
Plasmid#118596PurposeOne of three plasmids required to create CDK1as human cells by single transfection (One shot system). CDK1as cDNA and Zeocin resistance cassette flanked by Sleeping Beauty transposon.DepositorInsertCDK1
ExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Twitch-2B pcDNA3
Plasmid#49531PurposeFluorescent reporter for calcium signalingDepositorInsertTwitch-2B
TagsECFP and cpCit174ExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mScarlet
Plasmid#131001PurposeAAV vector to drive the expression of mScarlet under the control of human Synapsin promoterDepositorHas ServiceAAV1 and AAV8InsertmScarlet
UseAAVPromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW-tTRE-scFv-SunTag
Plasmid#193138PurposeExpresses scFv intracellular antibody component of the SunTag system under Dox regulationDepositorInsertscFv-SunTag
UseLentiviralExpressionMammalianPromotertight TRE promoterAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only