We narrowed to 5,937 results for: plasmid dna
-
Plasmid#98942PurposeMammalian expression plasmid for untagged human CXCR4DepositorAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-hACE2
Plasmid#145033PurposeExpress human ACE2 with C9 tag at C-terminal in mammalian cellsDepositorAvailable SinceApril 15, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.4_CEACAM6-His
Plasmid#149337Purposefor eukaryotic expression and purification of CEACAM6-His6DepositorInsertCEACAM6 (CEACAM6 Human)
TagsIL-2 signal peptide and polyhistidineExpressionMammalianMutationpoint mutation (GGA to GCA) to replace 'G-g…PromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-V5-Lin28A
Plasmid#51387DepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1neo-14-3-3-CLuc
Plasmid#107611Purposemeasure LATS activity by Luciferase AssayDepositorInsertpCDNA3.1hygro-BamHI-CLuc1433-NotI
ExpressionMammalianAvailable SinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-tvD-Cit-tevs-DHFR
Plasmid#116054PurposeReporter plasmid for measuring protease activityDepositorInserttvD-Cit-tevs-DHFR
ExpressionMammalianAvailable SinceOct. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-Tornado-split-nLuc
Plasmid#212612PurposeFor the expression of a split nLuc that produces luminescence only when circularized. To test your IRES of interest, clone into the EcoRI, BsiWI sites.DepositorInsertTornado-CVB3-split-nLuc
UseLuciferaseExpressionMammalianMutationC373T mutation in CVB3PromoterCMVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-mutTornado-split-nLuc
Plasmid#212707PurposeTornado split nLuc with a mutated 3' ribozyme so that circularization cannot occur.DepositorInsertmutTornado-CVB3-split-nLuc
MutationDeleted the partial 3'ribozyme sequence in T…Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL
Plasmid#80266Purposemammalian expression plasmid for MycLAP-STILDepositorAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Tras light chain
Plasmid#216294PurposeExpresses anti-HER2 Tras Light chain in mammalian cells. To be paired with Tras heavy chain to form the anti-HER2 Tras FabDepositorInsertTras light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Pert Light chain
Plasmid#216310PurposeExpresses anti-HER2 Pert Light chain in mammalian cells. To be paired with Pert heavy chain to form the anti-HER2 Pert FabDepositorInsertPert Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-39S Light chain
Plasmid#216297PurposeExpresses anti-HER2 39S Light chain in mammalian cells. To be paired with 39S heavy chain to form the anti-HER2 39S FabDepositorInsert39S Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MF3958 Light chain
Plasmid#216304PurposeExpresses anti-HER2 MF3958 Light chain in mammalian cells. To be paired with MF3958 heavy chain to form the anti-HER2 MF3958 FabDepositorInsertMF3958 Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL
Plasmid#34593DepositorAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sPDGFRalpha-Fc
Plasmid#136438PurposeMammalian expression plasmid for soluble ectodomain of PDGFR-alpha fused to IgG1 FcDepositorInsertPDGFRalpha (PDGFRA Human)
TagsFc region of IgG1 (a.a. Asp-221 to Lys-447) and L…ExpressionMammalianMutationExtracellular domain of PDGFR-alpha (a.a. 1-524)PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB4-Fc
Plasmid#200986PurposeMammalian expression plasmid for soluble EphB4 fused to IgG1 FcDepositorInsertEphB4 (EPHB4 Human)
TagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB4PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRFAM7ADelta2bp
Plasmid#62515Purposemammalian expression of human duplicated Alpha7 with 2 bp deletion (CHRFAM7A-∆2bp)DepositorInsertCHRFAM7ADelta2bp (CHRFAM7A Human)
ExpressionMammalianMutationpartially duplication of CHRNA7 with 2-bp deletio…PromoterCMVAvailable SinceMarch 20, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV Dnajc16-V5
Plasmid#175156PurposeLentiviral expression of mouse Dnajc16-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-HA-rM3D(Gs)
Plasmid#45549PurposeExpresses rM3D (Gs) neuronal activatorDepositorInsertrM3D (Gs)
TagsHAExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-Nb37
Plasmid#205514PurposeEndosome-targeted Nb37 nanobody that binds and stabilizes the active form of Gαs G-protein subunit.DepositorInsertendo-Nb37
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-Nb80
Plasmid#205518PurposeEndosome-targeted Nb80 nanobody that binds and stabilizes β2AR active conformation, blocking Gαs coupling.DepositorInsertendo-Nb80
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-Spike
Plasmid#145031PurposeExpress SARS-CoV spike protein with C9 tag at C-terminal in mammalian cellsDepositorInsertSARS-CoV Spike
TagsC9 and CD5 signal peptideExpressionMammalianPromoterCMVAvailable SinceApril 16, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.4_17G6-1 heavy chain
Plasmid#198249Purposerecombinant expression of heavy chain of monoclonal anti-AMP antibody 17G6-1DepositorInsertheavy chain of monoclonal anti-AMP antibody 17G6-1 (mouse IgG2b)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_17G6-1 light chain
Plasmid#198250Purposerecombinant expression of light chain of monoclonal anti-AMP antibody 17G6-1DepositorInsertlight chain of monoclonal anti-AMP antibody 17G6-1 (mouse kappa)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_7C11-1 light chain
Plasmid#198252Purposerecombinant expression of light chain of monoclonal anti-AMP antibody 7C11-1DepositorInsertlight chain of monoclonal anti-AMP antibody 7C11-1 (mouse kappa)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_7C11-1 heavy chain
Plasmid#198251Purposerecombinant expression of heavy chain of monoclonal anti-AMP antibody 7C11-1DepositorInsertheavy chain of monoclonal anti-AMP antibody 7C11-1 (mouse IgG2a)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_1G11F2-3 light chain
Plasmid#198254Purposerecombinant expression of light chain of monoclonal anti-AMP antibody 1G11F2-3DepositorInsertlight chain of monoclonal anti-AMP antibody 1G11F2-3 (mouse kappa)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_1G11F2-3 heavy chain
Plasmid#198253Purposerecombinant expression of heavy chain of monoclonal anti-AMP antibody 1G11F2-3DepositorInsertheavy chain of monoclonal anti-AMP antibody 1G11F2-3 (mouse IgG2b)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Lin28A
Plasmid#51371DepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only