We narrowed to 2,579 results for: pcas
-
Plasmid#111508PurposeExpresses a VPR transcriptional activator fused to the nuclease-deactivated S. pyogenes Cas9, which is governed by an inserted StaPL(TI) module, in mammalian cells. [TI = telaprevir inhibited].DepositorInsertVPR-dSpCas9[StaPL(TI)]
ExpressionMammalianMutationThe HCV NS3 protease carries F43L, Q80K, and S122…PromoterPGKAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2
Plasmid#98973PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 96bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 2 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-wtSpCas9-H840A
Plasmid#80453PurposeSpCas9 mammalian expression vectorDepositorInsertSpCas9_H840A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2T-cmv-SpCas9-TadCBEd-V106W-BlastR
Plasmid#193849PurposeExpress TadCBEd-V106W in mammalian cells with BlastR selection, Tol2 integrationDepositorInsertTadCBEd-V106W
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-HF1-P2A-EGFP (RTW3505)
Plasmid#139995PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-HF1(N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationHF1=N497A/R661A/Q695A/Q926APromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBK03 pCAS-Tyr-[gRNA: BsaI GFP dropout] (HygR,AmpR)
Plasmid#178987PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK01 pCAS-Tyr-[gRNA: BsaI GFP dropout] (KanR, AmpR)
Plasmid#178985PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpCas9(D10A)-T2A-EGFP
Plasmid#221230PurposeExpress nCas9 nickase (D10) with GFP reporterDepositorInsertSpCas9(D10A)-T2A-EGFP
ExpressionMammalianMutationD10AAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD0029_pIVTRup(BsmBI)_SpCas9
Plasmid#242535PurposeIVTDepositorInsertSpCas9
UseCRISPRAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC3A
Plasmid#209040PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC3A is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC3A-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6a-IVT
Plasmid#215833PurposeTemplate for in vitro transcription of CBE6a (with SpCas9)DepositorInsertCBE6a-SpCas9-2xUGI
UseIn vitro transcription templateAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF4
Plasmid#108295PurposepX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only