We narrowed to 11,210 results for: nar
-
Plasmid#51502PurposeCan be used to generate AAV virus that will express EGFP in the presence of CreDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVPromoterCAGAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE
Plasmid#162374PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8s
UseAAVTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
anti-GFP scFv [N86/38] with sortase tag
Plasmid#204419PurposeMammalian Expression of anti-GFP scFv with a sortase tag for direct dye conjugation. Derived from hybridoma N86/38.DepositorInsertRecombinant mouse scFv targeting GFP (Aequorea victoria)
Tags6xHis tag and Sortase tagExpressionMammalianAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE
Plasmid#162376PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8f
UseAAVTags6xHisExpressionMammalianMutationQ315LPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-2
Plasmid#184481PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-1
Plasmid#184480PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Neo)
Plasmid#140645PurposeCTCF tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1(nsp8-nsp7)(nsp12)
Plasmid#165451PurposeExpresses the RNA Dependent RNA polymerase complex of SARS-CoV-2 in Escherichia ColiDepositorInsertsnsp12
nsp8
nsp7
Tags14Histidine-TEVExpressionBacterialPromoterT7Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMEM216-mCherry
Plasmid#41633DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC-G418-YR
Plasmid#61767PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing nptII (neomycin phosphotransferase II) selectable marker on transfer DNA (TDNA).DepositorInsertsnptII gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-T/O-Ds1-mCherry
Plasmid#112855PurposeDox inducible expression in mammalian cells of Ds1 protein fused to mCherry fluorescent proteinDepositorInsertDCHS1 (DCHS1 Human)
TagsmCherryExpressionMammalianPromoterdoxycycline inducible promoterAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-NSP12 (SARS-CoV-2)
Plasmid#159107PurposeThe SARS-CoV-2 NSP12 coding sequence was cloned into a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag which is cleavable by the ubiquitin-like protease (ULP1).DepositorInsertNSP12
TagsHis-SUMO tagExpressionBacterialMutationNonePromoterT7Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hGPR56-IRES-GFP
Plasmid#52297PurposeExpresses human GPR56 and GFP in mammalian cells.DepositorAvailable SinceApril 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SMURF2_WT
Plasmid#82259PurposeGateway Donor vector containing SMURF2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Jaws-KGC-GFP-ER2
Plasmid#65015PurposeAAV-mediated expression of Jaws under the CaMKII promoterDepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCaMKIIAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-HA-His
Plasmid#171566PurposeBacterial expression of HA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-HA-His)DepositorInsertNb127D01-HA-His (CXCR2 Human)
TagsHA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a 6xHis PreScission SARS-CoV-2 nsp13
Plasmid#159390PurposeExpresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.DepositorInsertN-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
TagsHis6 tagExpressionBacterialPromoterT7Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-NbVHH05-ALFA-His
Plasmid#171569PurposeBacterial expression of ALFA-His-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-ALFA-His)DepositorInsertNbVHH05-ALFA-His (UBE2J1 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
GIV-WT - FLAG
Plasmid#65947PurposeExpression GIV/Girdin in Mammalian cellDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Beatrix
Plasmid#167528PurposeDual-color fluorescent reporter for the creation and detection of Cre-dependent tunable mosaics in floxed mouse lines and cells.DepositorInsertBeatrix
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterCAGAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_WNT5A_WT
Plasmid#82240PurposeGateway Donor vector containing WNT5A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only