We narrowed to 23,620 results for: crispr
-
Plasmid#91692PurposeMonocot Target-AID vector expressing rice-optimized dCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A and H840A for dead Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
TK1 gRNA (BRDN0001145069)
Plasmid#76424Purpose3rd generation lentiviral gRNA plasmid targeting human TK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001148851)
Plasmid#75734Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NUAK1 gRNA (BRDN0001162598)
Plasmid#75577Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.2
Plasmid#59912PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146004)
Plasmid#80174Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001147334)
Plasmid#75732Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149423)
Plasmid#80255Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Loop2-8A8G
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146586)
Plasmid#77947Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only