We narrowed to 7,096 results for: cas9 plasmid
-
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP791_PB_dCas9-SSSavi_BirA
Plasmid#211786PurposePiggyBac plasmid with dCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), and BirA, with Hygro selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpCAGG abd pEF1aAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectPromoterpActin (Drosophila)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA1
Plasmid#99734PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-VRQR-P2A-EGFP (KAC1309)
Plasmid#185913PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9-VRQR(D10A/D1135V/G1218R/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-VRQR-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-VRQR=D10A/D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpCas9-VRQR-P2A-EGFP (KAC1166)
Plasmid#185918PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpCas9-VRQR(D10A/D1135V/G1218R/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8.20m-nSpCas9-VRQR-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-VRQR=D10A/D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-SpCas9
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorInsertpRSV
UseAAVPromoterpRSVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IA304: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-VPR
Plasmid#121822PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only