We narrowed to 8,446 results for: gnal
-
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-CARzeta-GFP
Plasmid#89344Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFPDepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTT5-hSDC1-S15/25A
Plasmid#52364Purposeexpresses human Syndecan-1 serine 15 and 25 mutated to alanine (numbering excludes signal peptide) in HEK293-EBNA1 (293E) suspension culture.DepositorInsertSDC1 (SDC1 Human)
ExpressionMammalianMutationS15A, S25A and R95Q (according to numbering in Fi…PromoterCMVAvailable SinceDec. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [Chronos-GFP]
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
A3Ai E72A-Cas9n-UGI-NLS
Plasmid#109430PurposeExpresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.AU1.VSVg_NGFR
Plasmid#158351PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
iMb-Notch-Mosaic (IR99.40)
Plasmid#99749PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different membrane localized fluorescent proteins and Notch signalling genesDepositorInsertMbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Aequorea victoria, Human)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]
Plasmid#84485PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α, 1.1 kb long (short version)Available SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.VSVg_NGFR
Plasmid#158239PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-HGP-v3-Nb127D01-hIgG
Plasmid#171564PurposeExpresses hIgG-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-human IgG-TEV-Avi-His) in fly cellsDepositorInsertNb127D01-human IgG-TEV-Avi-His (CXCR2 Human)
TagsBiP signal peptide and hIgG1-hinge-N297A-TEV site…ExpressionInsectAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.VSVg_NGFR
Plasmid#158246PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.FLAG.VSVg_NGFR
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(RIT)-FLAG-AVITEV
Plasmid#74053Purposeretroviral expression plasmid for human NFATc2/C (with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.V5_NGFR
Plasmid#158235PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55762PurposeAn amino-terminal YFP fragment was fused to Ggamma2. When co-expressed with a carboxyl terminal YFP or CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(1-158)-gamma-2 (GNG2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only