We narrowed to 16,429 results for: grna
-
Plasmid#226860PurposeHuman gRNA expression vector backbone with BsmBI Golden Gate siteDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_N7-sgRNA2
Plasmid#190664PurposeExpresses U6-driven N7 sgRNA2 (poly-T mutated out), BsmbI dropout cassette for cloningDepositorInsertN7 sgRNA2
ExpressionMammalianPromoterU6Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-Cj-sgRNA
Plasmid#89753PurposeU6 promoter driven expression of Cj-SgRNA cloned with BsmbIDepositorInsertCj-SgRNA
UseSgrna expression under u6 promoterPromoterU6Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A
Plasmid#149369PurposeExpresses SpCas9 and sgRNA targeting the lenti-CDDR reporterDepositorInsertsCas9
sgRNA-A
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6c
Plasmid#66197Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6cAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A+B
Plasmid#149370PurposeExpresses SpCas9 and two sgRNA targeting the lenti-CDDR reporter at two distal sitesDepositorInsertsCas9
sgRNA-A
sgRNA-B
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLH-spsgRNA2
Plasmid#64114PurposeVector for expression of Sp sgRNA2 in mammalian cellsDepositorInsertSp sgRNA2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m
Plasmid#66193Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU3m (SpeI site destroyed)Available SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU6b
Plasmid#66196Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterOsU6bAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-th-sgRNA
Plasmid#65565Purposein vitro trancription of sgRNA targeting the zebrafish th locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3045(gRNA XI-3)
Plasmid#73287PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX_sgRNA_entry (CJT32)
Plasmid#181782PurposeExpresses ShHELIX containing a nicking I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-5sgRNA
Plasmid#64243Purposedestination vector for five U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-nmsgRNA1.1
Plasmid#64115PurposeVector for expression of Nm sgRNA1.1 in mammalian cellsDepositorInsertNm sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP53_sgRNA-1
Plasmid#88853PurposeCRISPR KO of Trp53DepositorInsertTrp53
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-lvaA
Plasmid#106397PurposeGuide RNA plasmid targeting lvaA on BBR1-UP originDepositorInsertsgRNA towards lvaA in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only