We narrowed to 6,235 results for: KIT
-
Plasmid#172901PurposeIntestinal promoter ges-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi5605 site on chromosome IIDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GFP
Plasmid#178713PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-dTom
Plasmid#178715PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianMutationPromoterCaMKIIAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GFP
Plasmid#178714PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4
Plasmid#170849PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5
Plasmid#170850PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6
Plasmid#170851PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hHBEGF
Plasmid#199234PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertProheparin-binding EGF-like growth factor (HBEGF Human)
UseTagsTrxA-6xHis-S-tagExpressionBacterialMutationPromoterT7Available sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormMutationPromoterAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)ExpressionMutationPromoterPmec-18Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#178730PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C entry vector
Plasmid#111752PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianMutationPromoterAvailable sinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-dTom
Plasmid#178717PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH126
Plasmid#162482PurposeSEC plasmid containing LG1 homology arms and vha-8p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormMutationPromoterAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only